Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig131
Contig Information
Length 1115 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs1f06    rwhvs1f06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_32230 [Oryza sativa Indica Group]
Score 709
Evalue 1.05038e-72
Total Hit Count 428
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig131
CAGCCGACGCCTCACAACCGCCGCCGCGCAGGCAGTCGAGCCGACCGGAGGAAGCCATGGATCGGTACCAGAGGGTGGAGAAGCCGCGGGAGGAGGTGCC
CATCAAGGAGAACGAGATCCGCATCACCACCCAGGGCAGGATGCGCAACTACATCACCTACGCCACCACCCTCTTCCAGGATAAGGGTTGCGATGAAGTT
GTATTCAAGGCAATGGGAAGGGCCATAAACAAAACTGTGATGATTGCAGAATTGATCAAGAGGAGAATTGTGGGTCTCCATCAAAACACTGCCACTGAAT
CCACTGATATTACTGACACATGGGAGCCACTGGAGGAAGGCCTACTTCCGCTTGAGACAACAAGGCATGTGTCTATGATTACTCTAACTCTTTCAAAGAA
GGAGCTGGACACGTCATCTGTCGGATATCAATCTCCTCTGCCTGCTGACAAGGTGAAGCCGTTTCTTGAATACGAGAATGAAGAAGATGCGCACTCGCCT
CCTGGGCGAGGAAGAGGCCGTGGCCGAGGCCGTGGAAGGGGAATGGGAAGGGGTAGAGGTGCACGTGGGAATGGATACATGGAGTATGCTGACGGTGGAT
GGGAAAATGAGCATGCTCCTGCCTATGCAGGCAATGGGTATGCTGACCATGGTCCAGCTTATGAGGGTAATGGGTATGCGCGTGGTAGAGGCCGCGGTTT
CAGGGGCCGTGGCAGGAGAGGTGGCTATGGTGGTCAGCCTGGTGGCTATGGTGGTCAGCCTGATTATCAGCATGATGGAGGGTATTATGATGAGGCACCA
GCGCCACCCCGAGGTGGGGGGCGTGGTTTCAGGGGGCGTGGCAGGAGAGGTGGCTATGGTGGTGGCCAGCCTGATTATCAGCAAGACGGAGGTTATTACG
AGGAGGCCCCTTTTCCTGCACCAGCTGGAGGTCGTGGTCGAGGCCGTGGCCGTGGGAGAGGCGGCCCAGCTCGTGGCAGAGGGCGCGGTGGCAATGCCAA
TGGCAACATGGTGTATGCCGCCGCTTCGGGCGCATAAGCAGTCCTCATCTCGCTGCTGTTGTTAGTTGGATGCCTGCTCCAAGCATGAATATGTATCATC
TGTGTTGTTTATCTG
page-top