Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig130
Contig Information
Length 898 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs1f18    rwhvs1f18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit serine/threonine protein kinase [Hordeum vulgare subsp. vulgare]
Score 580
Evalue 6.76578e-58
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig130
TAAGTACATCCCCTCCTGGTGTTCTCTTCCCGGCTTGGATCCCTGTGATCAAGTGTTCCTCTCAAAGCAATGAGCACCGGCGGTATAACCCTAGAAAACC
TACCGAAGGAACTACCCACTAGACTTTTTCAAGGAAATTACAAATAACTTTGCCAGTGAAATAGGTTCAGGTGCATTTGGGTCTGTTTATAAGGGGATTC
TGGGTGGTGGTGGAGTGGTGGCTGTGAAGAAACTCGCCGAAAATTCACCTGTGCCACGCGATGAAATCTTTAAGAAAGAGGTTCAGAATATCATGGTGCT
CGAACATGAAAATATTGTGAAGTTTCTTGCATACTGCCGTGAAGGACAAAACAGATTGGTCCAGAGCAATGGAAGACACATTATTGCAGAGATTACTGAA
ACTTTACTCTGCTATGAATACGTACCTAATGGGAGCCTTGAGCAGAATCTTTTTGGTGAATCCAGTAACATTGATTGGGACACACGTTTCAAAATAATAA
AGGGGATCTGTGAGGGTATACGTTTTCTGCATGGATTGCCTTGTCCGGTTCTCCATTTGGGTCTGAAGCCTCAAAATATATTCCTGGATGGAAACATGGC
CCCCAAAATTGCGGAATTTGGATTCTCCAGAATATTTGGGGAAGACCAAACACGAATGAACACGCGAAGTGTTGTGGGATCTGTCTCTCCCATCACAAGT
GAGCACAAGACTTCGCATTTTTCAATGAGATAAACCCAAGATAAAGTAAAACAAGATCCGACAAGGCTACAATAACACAAGTGAATGTGGGAACATGACC
CACTAATGTAACACCATTGCAGGAATATTTAAATTTTAATTCCATTGGATTTTTATTTGATAAATAGGTATCAAGAGAGAATAGAGTTACGCCCATTT
page-top