Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig112
Contig Information
Length 1044 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs1b20    rwhvs1b20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cation transport protein chaC [Zea mays] >gi|195630483|gb|ACG36635.1| cation transport protein chaC [Zea mays]
Score 994
Evalue 8.49131e-106
Total Hit Count 442
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig112
CCCATCCGTCCGTCCGTCCCGGGGAGAAGACCGCCGGCGGAGGAGAGGAGACGCGGGCGAGGCAAGAGGAGAGTCAAATCCCCATCTTGCTCCCCCCCCC
GCGCCGCCGACCCCACCCGCGGCATTCTCTCCGGCGTCCCTCCTCCGGCCAGGGGGAAAAGCAGCAGCAGGATGGTGCTGTGGGTCTTCGGGTATGGGTC
CCTGATCTGGAACCCCGGATTCGACTTCGACGAGAAGATCCTGGGATTCATCAAGGGATACAAGCGAACGTTTAATCTTGCTTGCATTGACCATAGAGGC
ACACCACAGCATCCGGCCAGGACCTGCACCCTTGAATCCGAAGATGAAGCCATATGCTGGGGAATTGCTTATTGTGTCAAAGGTGGTCTAGAAAAAGAGC
GAGAAGCAATGCAGTACTTGGAGAGAAGAGAATGCGAGTATGACCAGAAGATCTCTGTGGATTTCTACAAGGATGGAAATTCTCTGGAACCAGCTGTGAC
GGATGTATTAGTTTTCGTATCCACTCCTGATCCAGTTGGCAACAAATACTATCTTGGCCCTGCTGCTTTGGAGGATATGGCAAGGCAAATTGCTACAGCC
AGTGGCCCTAATGGATATAATAGGGACTACCTGTTCTCAATGGAGAAGGCACTGTCCAATATAAGCCATGAAGACGACTCGATCATTGTGCTTGCGGATG
AGGTGAGGAAGGTGCTGAGCAGGTCGACGGAGAAGAAGGTTACCGGCTCCGACATACCATTAAAATCGCATACACCTGTTGTGCACATCTCTGCTCTTCC
TGAGGGCACCGTTGCGGTTTCAACATAGTAAGAAGAGCAGCACGGCTGGATCAGCGAAAGAGATGGCATTTTCCTCTGACCACACTCACTCTTGACATTC
TACCATTGAAAGATCTGTGGTTTACTTCAGCTCTGGCACCATTGAGGGTGTGCGCTAATTTTCTTTGGCAACTATTGTGGCAAAGGCTGTAGCTTCCAGA
GTGCTAATGCGAAAGCCTAAGACTTCAAGTGTTATTGCTTCCCT
page-top