Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig98
Contig Information
Length 414 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs14c18    rwhvs14c18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit PREDICTED: similar to bric a brac 1 CG9097-PB, isoform B [Apis mellifera]
Score 75
Evalue 5.95294
Total Hit Count 2
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig98
CCTCGTGCCGAGTCAATGGGCATCGAAATCGCTCAAGGAATCTCGTGACCGGGTCTCGAGCATAGTTCATGTTGCTCCCATCTGCAGCCGCCTAGTTTCA
TCTGGCCTGGAAGAAGGTAGGGATCAGATTTCTTTTGAAGGAGAGAACATTTGCTGCTAGATCCGTTGAAATCATGCCTCCCTTTTCTGTGATCAATTTG
TACCATGTGACACATTTCTTCAGTGCAACCACATGAGGTTGGTGGTTGGCTAATAAGTTTGTTTCAGCCTGTGTGTTGTGTAACTCTGGGACAGAGGCTT
GGCACCACTGAACCTGTCTAACTGGAAATTGCAACTTGAACTCCTTCCATGTGAAGATGTTTGCTTGGTAAGGGGACATTGTTGCCGTGGACTTGGTTTT
TGGTAAAAAAAAAA
page-top