Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig97
Contig Information
Length 838 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs14c17    rwhvs14c17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit immunophilin [Zea mays] >gi|54111525|gb|AAV28625.1| immunophilin [Zea mays] >gi|195605690|gb|ACG24675.1| peptidyl-prolyl isomerase FKBP12 [Zea mays] >gi|195605704|gb|ACG24682.1| peptidyl-prolyl isomerase FKBP12 [Zea mays] >gi|195619378|gb|ACG31519.1| peptidyl-prolyl isomerase FKBP12 [Zea mays] >gi|195620748|gb|ACG32204.1| peptidyl-prolyl isomerase FKBP12 [Zea mays] >gi|195658115|gb|ACG48525.1| peptidyl-prolyl isomerase FKBP12 [Zea mays]
Score 550
Evalue 1.81112e-54
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig97
ACACAGCCCAGTTCCTGACGAACACACAGAGCCTGAGCATGCTGAATCGCAGCACACAAACACACCACCAGAGCATGTATAATCAAACAGTTACACCAGC
CTACAGCACCAGCTAATTAAAGCCTACCAACCATCTACATGACTACATCCACCTCGTGGAAGCATAATGCTGTATGTTACACAAGTGTTCAGTTCAACCA
CAGGACCGTACACCAGCGTCGACAGCAGCAAGCGCACTGCCACGCCGCAGAATCGCACACGCACACAACCACACATGCAAACTTTGCAACCATCCGAACA
TGGAAGCCCCTGAAGAAGCTCACTGGTCGATTCCGACGCCAAGCGCACCACCACCGATCAGAAGCCACCACGCCAACGCTGCGCCGCCGCCGAACTTTGG
AGAGGAGACGCGGAGGACGGGAAGATGGGATTCGAGAAGGAGATCCTGAAAGCCGGCACCGGCCCCAAGCCCGTCAAGGGCCAGAAGGTCACCGTCCACT
GCACCGGCTACGGGAAGGATGGTGATCTGTCTAAGAAGTTTTGGAGTACCAAGGACCCTGGGCAGCAGCCATTCTCTTTCAACATTGGTCTGGGTTCAGT
GATCAAAGGATGGGATGAGGGAGTTATGGGCATGCAATTGGGTGAAGTCGCCCGTCTTACGTGCACCCCAGACTACGCTTATGGAACTGGTGGCTTTCCA
GCCTGGGGAATTCAACCAAACTCCGTGCTGATATTCGAGATCGAAGTTCTTAGCGCCAAGTGATTCATGATGGATCCATAGGGCACTGCCGCATCGCCAT
GCCTCTCGATTACCAAAATAATTGTAATGCCACATCAT
page-top