Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig96
Contig Information
Length 1057 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs12p21    rwhvs12p21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit calcium-dependent protein kinase [Triticum aestivum]
Score 1074
Evalue 8.52391e-146
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig96
ACAGGGGTAGCACAAGCTATTCTTCGTGGAAATATCGATTTTAAGCGGGAACCCTGGCCTAATGTATCGGAAAATGCTAAAGATTTGGTTCGACGTATGT
TGGAACCAGATCCAAAGCTCAGGTTAACTGCAAAGCAGGTTCTTGAGCACCATTGGCTTCAAAATGCTAAGAAAGCTCCCAAATGTTCCTCTTGGCGATA
TTGTCAAGTCAAGGCTTAAGCAATTTTCGAGAATGAATAGATTCAAAAGAAGAGCTCTAAGAGTCATCGCTGATCATTTGTCAGCTGAGGAAGTTGAGGA
TATAAAGGAGATGTTTAAGGCAATGGATACTGACAATGATGGCATTGTCTCTTGTGAAGAATTGAAGAGTGGGATAGCAAAATTTGGCTCTCACCTTGCG
GAATCAGAAGTGCAGATGCTTATTGAAGCTGTGGATACAAACGGTAAAGGAGTACTAGATTATGCCGAATTTCTAGCTGTCTCTCTTCATCTGCAAAGGA
TGGCAAATGACGAGCACCTTCGGCGGGCCTTCTTATTCTTCGACAAGGATGGCAATGGTTACATCGAGCCGGACGAGCTTCGAGAGGCTCTGAAGGATGA
CGGAGCAGCTGATAGCATGGAAGTTGTGAATGACATACTGCAAGAAGTTGACACCGATAAGGATGGCAAAATTAGCTACGACGAATTCGTGGCGATGATG
AAGACGGGCACAGACTGGAGAAAGGCATCACGGCACTACTCGAGAGGCAGATTCAACAGCCTTAGCATGAAGCTTGTGAAGGACGGTTCCGTCAAATTGG
GCGTGGAGTAAAAGCCATGGTGTTTATTTGTGCATGTAGTTAGGCATTTGGGCCCCACTAAGCAGCAGCTCCTTTAGTTTTTGTCATGGTCGTTTTGCGT
GGAAATTTAGATAGGTGGAACCCCCTCTGATTGGCTCACATGTGTAATTAGTTCTCCTGGATCAGTGGCAGTCGCACGCACGCGCTGACGGATGTACCAA
GAGCAGTGCGCCTGCTTTTCTGAACCACTGATGTTAAGTGTTGTACCAATGTTTGCC
page-top