Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig95
Contig Information
Length 680 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs13e06    rwhvs13e06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit early nodulin protein [Brachypodium sylvaticum]
Score 364
Evalue 4.46603e-33
Total Hit Count 49
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig95
GCCGCTCACACACTACTACTACGGATCTCAGCCAGGAGTACTCGAGTTCACTAGCTAGCTACTAGTTCACTTCCTTCGGCACCAAGCTCTCTCCGGCGAA
GATGTCCACGGTGACCCGCTCCTACCTCGACCAGAGGCTCGCCGCCGCCCAGCGCTGCTCCAAAGAGGCTGCCATGGCGGGAGCCAAGGCCGCGGCCGTC
GCCACCGTCGCTGCCGCAGTCCCCACCCTGGCGAGCGTGAGGATGCTGCCGTGGGCGAGGGCGCACCTCAACCCCACCGGGCAGGCGCTCATCATCTCCA
CCGTCGCCGGGATGGCCTACTTCATCGTCGCCGACAAGACCATCCTCTCCATGGCCAGGAAGCACTCGTACGAGACGGCGCCAGAGCACCTCAAGAACAC
ATCCTTCCACTAATTAGACACTTGATTAGCCAGTGCCAATAAAGTGTGTACGCAGGCCCGTACGTGTCTTCTGAAACATATAGTAGTATAATGTTGAGCG
AGGCGATGGTTGCTGTGCGGAAAGGTGGTGTATAACCCTTTTCTGCGAGCAAGCACTAATTATCTGATGATTTATGATGTAGTACTCCATAATAATGTGG
CCATGTTCCCCATCGTACTAGTATCTTTCCAAAGGTCATGAATCAATAACAACCATAGTTTTGATTTTGTAAAAAAAAAA
page-top