Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig94
Contig Information
Length 1060 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs13a01    rwhvs13a01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os12g0502500 [Oryza sativa (japonica cultivar-group)] >gi|108862714|gb|ABA98641.2| hydrolase, carbon-nitrogen family protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|113649337|dbj|BAF29849.1| Os12g0502500 [Oryza sativa (japonica cultivar-group)]
Score 741
Evalue 2.82566e-115
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig94
AGTCTGTTAGCTAGCCGAACCATTAGATGGCCCAATAATGCAGAGATATTGCTCACTTGCAAATGAGTCAAGTATTTGGTTGTCTCTTGGAGGGTTTCAA
GAAAGGGGCCCAGATGATTCACACCAGTACAACACTCATGTATTAATCGATGAATCTGGAAAAGTTAGGAGCTCATACCGGAAAATTCATTTGTTTGATG
TGGATGTACCTGGCAACATGGTGTATAAGGAAAGCCCGTTTCACGACAGCAGGTGATACCGTCGTAGCGGTGGATAGCCCTTTTGGACGATTGGGCCTTA
CTGTTTGCTATGATTTGAGATTTCCAGAGCTTTACCAATGTTTGCGTTTTAAGCATCAAGCTCAGGTCTTGCTCGTACCATCTGCATTCACAAAGGTAAC
TGGGGAAGCACACTGGGAAATTCTCCTTCGTGCTCGTGCAATTGAGACACAATGTTATGTTATTGCTGCGGCTCAAGCTGGAAAACACAATGAGAAAAGA
GAAAGCTATGGCGATTCTATAATTATTGACCCATGGGGAACAGTTATAGCTCGACTTCCAGATCGACTGTCCACTGGATTTGCAGTAGCAGATATCGACT
TGTCAAAAGTTGAGGCTGTGCGAACCAAAATGCCAATCTCTGTGCACCGCAAGTTTGAGAGCATCTGGAAGTCCTCATCACTATAATAGTTGAAGGTGGT
CTTGCACGCTTCGCCGCTCTTATTCTCACATTCCGGAGATTCTTCTTTTGTGTATAATAACTGCCATTTTGTTCACAAGATGGTCCAGTTCGATTGGGAT
TTCCAGTGAGACATGTCATAGAACTAAATAAGCTACAACTGTAGTAGCATATCTAGTAAATAGGGCATATCCAAACATGGCTCAGAGCACCTTATGACTT
GGTTTGAGATGGCTTCTACCTCAGCTTATGGTCCAGATAAACCAGAAGCCGTTCCAAACCCAAAGCTTAGGAACAGCTTAGGTTGTGTTTGATTGGGCCT
TAGGGTCTTTTAAGCCAAAAGCTCAACCAAATCCAGCGAATTTGATGTTTGTGTGTATGT
page-top