Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig92
Contig Information
Length 544 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs14b16    rwhvs14b16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit nuclear protein ZAP-like [Oryza sativa Japonica Group]
Score 479
Evalue 1.06218e-48
Total Hit Count 26
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig92
AATGGTCAAAAGATTTTGATGAGGATACTGACAGGTCCCAAGCATGCAGATGGAAGTACACATACTCTTTCTGGGCTGGCCAAGACATATGGCACTCATC
AAAAAACACTTACTTGGGGTGATCGGCTTGAAAAGGGTGGATTTTCTATCGGTGCAGCCAAAAGGAGACCCACTTCATCTTTAATCATAGGACCTGGATC
AGGGTACAATTTGGTCTCCAACCCCTTGGCTGAAGATAATTCCACAGGCGTGAAGGATAAAGTAAACAATGAAACAAAAAGACGGTTCAGTGAGCAACTT
CGTGATGAAGGTCAATCCTTCAGGGCAGTTTTTGACCAGAGAAAACAGCGCATTGGGGTTTTCGACAACGGGAAAAATGAGTAATCCGTGACTGAGAAGC
CTGGATGGCAACCTGCAGTTGTATGGGCCTCTGGGTACTCAAACGTTGCCCAGGGTCAAGCAGAGCACAGGCAGCTCGGAGTCCTGTTGCTCCATTGCCA
TTGGCATATTGCAGTTCTAANATTTGCCGGGCACATATAGGCTT
page-top