Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig88
Contig Information
Length 1313 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs13a17    rwhvs13a17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ATP-binding cassette, sub-family F (GCN20), member 2 [Gallus gallus] >gi|53127704|emb|CAG31181.1| hypothetical protein [Gallus gallus]
Score 98
Evalue 8.06833e-07
Total Hit Count 431
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig88
TGCTTTTGTCTGTGAACTAATAACAATATTGCTGGCATTCTATGGCAACATTTGCAGATCTTGAGGCATGTGTGTGGCTGGAAGAAACACTCAAGAAATT
TGACCGTATACTTGTGACATCACTCTCAGGACTTCATGAATGGAGTGTGTACCAACATCATCCACATGCAGAACAGGAAGCTGAAGCTGTGAATATAGCT
GGCAATATTACTAATGTTGAAGCTGAAGCTTCAGCTTCAGCTTCAGATTCTCTTGTGCTTCCAACAATATTGCTGGCAATATTACTAATGTGTTAAGTTG
TCTAAACATGCTTGCTGCTAGCTTTAAAGTTGATCTAAAGAACCATTCATGCATTTACACATTCATGATTTCCTCTGCTGTTTGTAATTATTCTGGTTAA
CTTGCTAGTAGATATTGCCTGGGATTTGTAGCTGGGTAGATATTGTGTCATGTCCTCTTAGACGAGTTCATTTATTGAAAAATATTTCACATGTAGGGTA
AATATGTCAGTAAATCTGTAAAATATCTTCTTTATAGTTTTTCCTCGCATGTTCAGTATTGTGTCTGGCATGTTCATAGAGCCACTTGTGGAGTGAGATG
GGAATAACAATTATACTTCTGTAATGTTTGATCGTATAGATATATGCAAAAGTTGCTGTGCATTATCATTAGTTTTGATCGCTGCTTTACTAATAACTGT
GAATGCAATAGTGTGATTGTGGTCTTATTGACTTGCAAGTTTACTATTTCGAGAACCATCATCTTATTTTCTTTAACATAGTAGTTTACTATTGACGTTT
ACTATTGAGGAATAAGAGGAGATATGAAGTTTATATTGACGTTTCATGCAGGTCGGGTTACCCAATGTTGGCAAATCAACTTTCTTTAACATAGTAACAA
AGGTGGGCTCTCGCGCCGGCGACTCCAGGCTCGCGGTGAAGAAGAGCAAGGCCGAGAAGGACCCCAACAAGCCCAAGCGCCCCTGAGTGCCTTCTTCATC
TTCATGTGCTCTGCTCTTGCACACGTCAGGCACCGTCTCTGGCGCGGTGGTGCTTCTTGAGGCGACCGACGTGATGGTGGCTGTGTACGGCGGCGACCAC
AAGCTGTCCGGTGAGTCGGCTCCATCTTCTAGCCCTAGATCCCACTTTTCCGCTCCTATAGCATGCTCTGTTGGTTTAGAACACTAGCAGCAGTAGCCTA
CCATGTATGCGTACTAAACAGCAGGAGTTCAATCACCTTGTGTACACTAGTAGCTTGCTTACACAGTTGTCACTTTTGCTTGTGGTAGCCCATTATGTGG
CTGAATCATGTCT
page-top