Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig87
Contig Information
Length 261 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs13b04    rwhvs13b04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ALG2-interacting protein X [Zea mays]
Score 112
Evalue 0.000312387
Total Hit Count 16
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig87
GCCGTATCCACAAGCACCGTACAGTGCCCCAGGCGCGTACCCTCCTCATCACCAGAGCAACTACTACAGGCCTCAATGAAAGACCAACTTGGTCTGGAGG
AACGATTTGTTCTCTTAATTTTTCTCGCGGATATGTGTCCTTGTGGATTCCATTCTTGTGTATACTGGCATAGTGGTTACGAGTTCCGGTGGAGTAATGT
CAATTATGCTCGGGNTGGTTAGGCGGTAGCCTGTATGATATGTAGCGTGTAATAATGCAAT
page-top