Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig86
Contig Information
Length 806 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs14a23    rwhvs14a23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit biostress-resistance-related protein [Triticum aestivum]
Score 877
Evalue 2.02353e-92
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig86
CCCAACTGCACCTACGAGGCCTGTGGCAATTTTTGGTGGATTCCCATCTACTGCATGGTTTGATGTTGCTGATCTTTCAGAAGATTCTCCTGATGATGTT
GAGGGGCTGGATTCCTCAGCTGCACATGTTGCAAATTTATTGTCTACCGAACCTGCAGATATCAAGCTTGGCGTTGGTGGCTTTAGTATGGGTGCTGCTA
CTGCGCTTTACTCCGGTACTTGCTTTGCTCATGGAAAATATGGAAATGGCAATCCTTACCCTGTGAACCTAAGTGTGGCTGTTGGTCTCAGTGGCTGGCT
CCCATGCGCCAGGTCATTGAAGAACAAAATTGAGAGCTCACAGGAGGCTGCACAGAAGGCTTCATCATTACCTCTTATGCTTTGTCATGGAAAAGCTGAT
GATGTGGTCCTCTACAAACATGGAGAGAGGTCTGCTGATGCACTTAAGTCAACCGGGTTTGCAAATGTGGAATTCAAGTCCTACAGCAGACTCGGGCACT
ATACCGTTCCAGAGGAGATGGACGAAGTCGTCAAGTGGCTTACGGCAAGCTTGGAACTCGGCAGTTCCACGTCAACTTGATCGAATGAAGAGATGCCTTG
AGAAAGGCTCGGTGTAGCGGCGTCTAAATAATAAGTACCTGTGGTTGTGCCGAATTGAGTGATAAAATGGCTGGGTTGCCAACTTGGGCTTTGGGTATAC
GGTCATGTCTTAGCTTGGTGTTTCATATGCGGACATGCCTCGCTGAATCTTGGTACTATTGAGATTTCCATATATTTGGTATGTGTTTCCATCCAAAGTT
GTGATC
page-top