Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig84
Contig Information
Length 781 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs14a18    rwhvs14a18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unnamed protein product [Homo sapiens]
Score 106
Evalue 0.00487076
Total Hit Count 382
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig84
TCCCTCCCCACCTTCTCCGAAGCGGTGACCCCTACCCTCCCCACCTTCTCCGGCGGCGCCGCCACCACCTTCTCCGGCCGCATCCCACGACACCACCTTC
TACGCCAGCCGCCACCCTTTCTTTCTCCCTCGCCATCAGCGGTCATGGCGGGATCCGGCCGCCCCTCGGCCCCCAACGCGGCCTCAGCCACCGGATCCAG
CCGCCACGACCATTGATGCGGCCATAAACGACGAATCCGGCCACCACCGACCCTCAGTGTGGAATCCGTCCACTCGCACAGCCCGACGCTGAATCTGGCG
AAATCCACACCGGTGCCTCTGCTGCCCTCGGTGGATCCGGCCCTGGTCGTCCTCTCCCTCTCCGGCAGGGAGGCCCTGTCGAGCAACTCCCTCACTTGCC
AACGGGAGGAGGCCGGTCAGGAGGCATGCTCTAGCACCCCTCCGCTCCCCGCGGTGGATCCATGAGCAAACCAACCTACTCATTCAGCAAAAATCCGCGC
GCGTGCAGCCGGGCTCCTTCCCCCACCGCAAAAATCTGACCCCCGTCGCCTCCTCCTCATTCAGGTGACCTTCCCCTACCTCCTCTATAGCAAGACGACG
AGGGGCTCTTCTCCCCAACCTCTCTGCCGACCCCTTTCCTCTTATTCTGATGAGGTCCCAACCACCAACGGCATGCAGTATGGAGGCGTGATGCCATGTA
GCTCACCATGTGCATCCCATCCCAGTATTGTTGCTGTTCAGAATAATTTCCAATGTTTTTCAGAAAAACTGATGTAATTGG
page-top