Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig82
Contig Information
Length 200 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs13b13    rwhvs13b13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein L7 [Triticum aestivum]
Score 89
Evalue 0.143893
Total Hit Count 30
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig82
GTGACGCTGGTAACCGTGAGAACTACATCAACCAGCTTGTTAGAAGGATGAACTAGGTTGAAGGAGCTCCTTGATAATACCCTGTGTTGGAAGGATAAAC
TTGTTTCACATTAGGAAGCGGATGATGAATATGCATGCGTTTTTTGTATTGAGAACTAGACATGTTTGGATGAAATCTCACATTTCCCCTAAAAAAAAAA
page-top