Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig81
Contig Information
Length 895 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs13b16    rwhvs13b16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0219600 [Oryza sativa (japonica cultivar-group)] >gi|51535367|dbj|BAD37238.1| putative poly(A) binding protein II [Oryza sativa Japonica Group] >gi|113595203|dbj|BAF19077.1| Os06g0219600 [Oryza sativa (japonica cultivar-group)] >gi|215704439|dbj|BAG93873.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765746|dbj|BAG87443.1| unnamed protein product [Oryza sativa Japonica Group]
Score 557
Evalue 6.58982e-61
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig81
AATCGCCCTCGCGTTAGGTTAGGCCGAGGCGAGTAGATTCGGTTTCTAGCTCAGCAACGCGGCGGCCATGGAGGACGAAGAGCACGAGGTGTACGGCCAG
GAGATCCCCGTCGACGGCGAGGACGTCGACATGGGCGCCGGGGGCGACGACGCCGCCAAGCTGCACGAGCTCGACGAGATGAAGCGCCGTCTTCAAGGAG
ATGGAGGAGGAGGCCGCCGCCCTCCGCGAGATGCAGGCCAAGGTCGCCAAGGAGATGCAAGGCGGAGATCCTAATGCGACCACATCTGAAGCAAAAGAAG
AGATGGATTCTCGTTCTGTTTTTGTTGGAAATGTTGACTATGCATGCACTCCAGAAGAAGTGCAGCAGCATTTTAATTCGTGCGGAACCGTCAACCGAGT
GACTATCCTGACCGACAAGTTTGGGCAGCCTAAAGGTTTTGCTTACGTTGAATTTGTTGAAGCAGAAGCTATTCAGGAAGCTGTCAAGCTGAGTGAGTCA
GAGCTTCATGGTCGGCAAATCAAGGTAGCGCCGAAGCGAACTAACGTTCCTGGGTTGAAGCAGCCCCGAGGGGGCCGAGGATTCAACCCATATGGCGGCC
ACCCCTACATGAGGCCATATCCTCCACCGTTTTACAATCCTTATGGTGGTTATGGGAGAGCTCCCAGGTTCCGCCGTCCGCGCAGGCCCTTCTACTAAGT
TGTGGCTCTACTGGAGTTCTGTCAACACATGACAACACTAGTCTTCAATCGATCTTAAGCCAGTCACCAGAGAACTCAAATCCTTGCACCGTGTTTCATT
ATTTCACAGAAGGATATGGGATGGTTGTTGTGTAATCTACTGTGTTGTGTTGAAAAATGTTTAAGCCACTACATGCACCAGCATTATGTACTATT
page-top