Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig80
Contig Information
Length 1528 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs14a05    rwhvs14a05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Maturase K; AltName: Full=Intron maturase >gi|32816571|gb|AAO39153.1| maturase K [Chara connivens]
Score 88
Evalue 1.65176
Total Hit Count 3
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig80
GGGCTACTTACCTCTTGACAAAGGTTGTATTTCACAGAAGCATGTATTCTCAGTTTCTCACAGTAGCCAGAGTGTATCGCTTTTTTATCTGGTAATTCTG
TTCTCATTAATGTTAATGTTTCCGTACGAAGCAAAGGGCACTGGTGCTGGATGGATGCCAGCAGCTATTCTGGCAATGGTAAATTGCACTTGATTTATAG
ATGTTTTCATTTTCATATGCCACGGTCTAAGTGGAAATATAAATACTTTTCGATGAAGCTAGGGATGCCATTAAGTAGCTTTAGCTTTACCTATCTTTGG
GTGGGAACATTACACTCTTCAACAACGAAAGAGAGGGCGAGAGGTGATCCTTCTGCTCTTTACTTGTGAATCTCTATTTCTTACTAGCTCGGGGAACTTG
CACCCAACAAATTAATGGATGATCTTGCAAACCTCATCAAGTATATTAGTAGTTAAACTGTGAATTTGAAAACAAAAAAATTGTACATTTGTTCGTGTTG
AATTTAGATGTGTTCTTGGGCAATAATTGATGGTAGATAATACATGATGGGGGATGGCCTTCATTGCTACAATTACTTTTCCTATCCCTCCTTAGTTTCT
TGGATGTATATTAGTTTTTGTTTGCCCCTTTATTTTTAGGGGAAGTTTTCTTACTGCCACAGGCTTGGTTGTTCTAACATGACAAAATGTTGGATTTAAT
ATCTTGCTAAATACTGGATACTAGCTCATTTTTACTTCAGCTCATAAGGAAAGGTCTGTATGCAAAGCGTGTCATGGGACGGTATGCTGGAATAAACACA
TATAGCCAGTTCATGTTTACCCTTTTCTTTACACATATGATTGAGACTAGCAAATTCACATATACAAATATGTTTCTAGAGCAAGGATGAGAAGCACTCC
ATAAACAACCACAATTGATGGGATGACGGAACTTTAGGTCAAACCACACAGGTTTCGCTTGTTGATATTTCTGGCATATACTTGATGAAATATACATAAA
TATGTGTTCTTTCGTATAGGTTTTCACCAGAATCAAGCATCAGTTCAATGGGAACTGGAATGATGAAAACACTTGTCGTGCCTCAGAGTGTGGCGCCGAA
GAGAAGGACGAGCAGTCAGTGGTGTCTTCGTCTTCGCCGATTGTGCTGTGCGTAGATGCGGAAGACCGGCAACCGACGGCAATATGTTCATGTGGCTTCA
AGCATAGGTTATTCATGGAGTTACATAGTTTGAAGTCCCTTTTGTATTATTCTTAGGAGAATGGAGTAAATAATATGTGATGCCTTGTTCTGTCAATACC
ACTGTAAAGTTTCGGTGTTTAATTTTCTTGGTGATCTCTCATAGGTTTATATATATGTTCTCGGTTTCTAGAATTGTTCTGTATTATCTGCAGATATGCC
ACAATTGCCACCTGAGGCCATTATGAATTGTGGTGGGATGGCACAAACAAGAAGAGATGGTATCAGGTGACTTAGTGATAGTTTTGCTTTGGGAGTATTA
AGAAGAGTGACCACCGTATTGTGGTAAA
page-top