Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig89
Contig Information
Length 874 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs13a15    rwhvs13a15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit NADPH-dependent HC-toxin reductase [Hordeum vulgare]
Score 1130
Evalue 1.07793e-121
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig89
GTGCGCATCATCCTCCGGCTATGCGCGGAATCTATGACGGTGAAGCGCGTCATCCACACCGCATCGGTGACGGCCGCTTCGCCGCTGACAAAGTCCTCCA
GCGCCGCGGCCGCTGTGTACAGCGATTTCATCTCTGAATCTTGTTGGACTCTGTTGGATGTCGATTACCCTCTCCGGAGCGTGCACTTCGATAAGTACAT
AGAGTCCAAGGTCCTGTCAGAGAAGGAGCTCCTCAGCTACAACGACGGCGAGAGCCCGGCGTTCGAGGTGGTCACCCTGTCGTTGGGCCTTGTCGGGGGC
GACACAGTGCTCAGCCACCTCCCAGAGACGGTGGAGAGCATGGTGGCCCCGGTAACAAAGCAAGAGCCCTACTTCATGCTGCCGAGGATCCTGCAGAGGT
TGCTGGGCTCGCTGCCGCTGGTGCACGTCGACGACGTGTGCTCCGCGCTCATCTTCTGCATCGAGCAACCTGCCCTCTCAGGTCGGTTCCTCTGTGCCGC
TGCCTACCCGACAATCCACGACATCCTGGACCACTACAGCAGCAAGTACCCCCATCTGGATCTCCTCAGAGAGGCTGATGAGGTAGCGAGGGTGCAACCC
GAGAAGAACAAGCTTGTGGAGCTGGGCTTCAGGTACAAGTATGGGGTGGAGGAGATACTAGACGAAAGCATTGACTGTGCTGTGAGGCTGGGCTCCCTGG
ATGCATCCAAGCTCATCGTCCAGCAGGAGTGATGAACTCAATGATGTCGAGGGCAAGTGATCACAGTATCCTCTTTACTTGTTCAGCATTTACAGTAACA
CATGTATTAAAAGAAGAAAAACGGTACATAAATAACAGAGCTGCTTTGTTATTTACTGGCAGCNTAACGTAGCT
page-top