Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig79
Contig Information
Length 1329 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs13b19    rwhvs13b19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_004723 [Oryza sativa (japonica cultivar-group)]
Score 141
Evalue 9.85713e-07
Total Hit Count 145
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig79
AACAATTCTCTCCTCCCCTCATCATCGATTGATCTTCCTGTAGTTAATTTTCTTGCTTAATTCAGCCCCGTTAGTTGATGCTATGCCTGGATGGATGCTT
GGCATGTTACGTTCCAGGAAGCGGAGGCGGCCATTAGGGCGTGCTTGGGTCCGTACCCGGTGATTGACGGCCGGAGGGCCAACTGCAACCTCGCCTGCCT
CGAGGTCCAAGGCGCCACAACGAAAACGCCCGCCTCGATACTCAGCTTCAAGGGATGTGTCCTGCCACGGATAGTGCCATCACACCGGCACAATGAACTA
GCTCAGTTTACAGCACTGCAAATTATCTAGATATCCCTCCCCTTGTTACTTATTAAGCCTCTAATCACTAATTTCCAGCAAAGGCTTTTTTACATCAGTT
TTCCAGCAAAAGTTTATGATAAATAATGTTGATTTGTTGTAACACAGTTAACATCCCTTCCTATTTATCTGCACACCTTTTATTTTATTTTATTTTGTGA
TGTTGTGGGAGTCTATAGAACACATGTCATTAAAATGTTTATCCCAAACCAGTTCTTTGCAGGTTTATTAATGATGATCTATGCATTGGTTTCTTACTTT
GTGAACTGAAAGATTTTGTTTGCTCCTCCTATTGAATATTTACATTGGGACTATATTTTTTGCGGCAAATCCTCATCGGAATTGTAGATTAAGGATTAGT
ATTATGGCTTAAGTATAATGATTCTACTCTTATATAGCAAGTATTCAAATAGTATGTCGTACAAGAATGTAAGATGTCTGCACCCTGCATTATAATGATT
GGAGTTACTGTAATAATTCTTGCTGGTTAGTTACCTCTGCTCCTAGCTGGCCAAATTAGAACTGATACTTACATGTGTAGGATTGTTGTGTGAGAGTCTC
ATAGATTGGCACATGGATGGAAAATAAGTTTCAGTTTTAGCTTGTTGTACTGATCATGGCTATGTTGTGGAAGAGTTCTTGCAGGCAGTGTTCACAAGTA
CATCCACTCACAACCTCTCCCATGCTGCAGATGCAGAAGGGTATTTTGTGAAAAATGAGGGAACAGCTACTCTGATGGTCCTCATCCTCATCCGGCCTTA
ATTCCAAGGACTGTTTTGTGAGAGTCTCATAGATTGGCACATGGATGGATAATAAGTTTCAGCTTTAGCTTGTTGTACTGATCAAGGCTATGTTGTGGAA
GAGTTCTTGCATGCAGTGCAAGCACATCCACTCACGACCTCCCCCATGCTGCAGCTGCAGCCAATTTGGGGACCCTTTCATGGACAAGCAGATGGAGCTG
TAGATTGGGAGTTGTTCTTAAAGAACTTT
page-top