Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig76
Contig Information
Length 688 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs13b20    rwhvs13b20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit PREDICTED: similar to Mucin-1 precursor (MUC-1) (Polymorphic epithelial mucin) (PEM) (PEMT) (Episialin) (Tumor-associated mucin) (Carcinoma-associated mucin) (Tumor-associated epithelial membrane antigen) (EMA) (H23AG) (Peanut-reactive urinary mucin) (PUM) (B... [Macaca mulatta]
Score 92
Evalue 0.159767
Total Hit Count 52
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig76
GGCAAGGGTCGACTTCGGCCTGCTGCGTGGGAGTGGCTGCCCGGGTGAAAGCCTGGCCGGTGCTGGCCGGCCGCGGCGACGGTGCCTGTGGGCGTCGCTA
TCCTCCTTGGAGGCGTCGTCGGGAATCTCACAGCCGGATCTTCCGGATCAAGTACTTCGGGTGAAAACTTAGATCCTGCTGCATGGTCGGGCGGTAGCGT
CGTCTTGAACGTCGTTCCCCTCTTTAGGGTGCCGTCTTGAAGACTTTGATCCTTGTGGTGCCTTCCTACGACTGGACGTGCACGGTGGCTTCTGTGGCAA
TGATGACAGTGGGGAGCAATGCCAGAGGCGTGGCCCTGGTTGTGGTAGCCGACTCTTCTTCTTCGACGCGTCTGTGGGAGTGCCTCGACTGTCTGTTGAT
GTGAAATCGAAGCCGTGGTGGGGGACCAGTGGTATACGATGATGCGTGACAGGTGATTCGTTCGGTGATCCTCCGTGACGCCACCCCTGCCCANTTTCCT
TANTANTTCATCGTCGGANTCNGANCTCCACTGCCTANTGTGGTTTGTAAGGANTGTTGTGCTGCANCTTCTANGGCTGCTGTTTTTCCTTTTGTCTTTT
GATCTTCNNATCCTCTGNTCCTANGACCTTCACCANCTTGTTATTTTCCNNTNCTNCCTCAATNAANGNCANCAATGCTNNATCTTTC
page-top