Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig71
Contig Information
Length 528 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs13p08    rwhvs13p08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit plastid-lipid associated protein pap [Oryza sativa (indica cultivar-group)]
Score 282
Evalue 7.64007e-24
Total Hit Count 120
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig71
ACCCCAGATCAGTTGATGAATATCTTCCAGAAGAACTACGACATGCTCCTTGCCATATTCAACCCAGAAGGTTGGCTTGAGATAACATATGTTGACGAAT
CTCTACGGATCGGCAGAGATGACAAGGCAAACATCTTTGTTCTGGAGAAAACAGACCCATCTCAAGTGTAAGAAGATCTACGAAGCAAAATGTGTGCAAA
TATTCGTAATTTCTGACAATGAGTGCATCGACACTCAGAGAAGAGGCCACATTAACGTATTCCGCGGCACAAATGATTGTTAACAGCTCAGTGCAGATCA
TCGATTCAACCACTCATCAATTTCTCCTGAAAAGGATAAGCAGCATTCTTTTTTACGACTGTAGAAACATTTGTTTTTTGGATTTTTTTAGCTGTGCACT
GTCAATGTATCAATGTAAGTATGTAACTATGAAAGTTCAGTTACATAGAGAATCAAACTGCCCCATCACCAGGGAGCAATTAAACAAATATCCAATTTTG
AAATACAATTTTTTTTTCNAAAAAAAAA
page-top