Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig70
Contig Information
Length 1121 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs13c18    rwhvs13c18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_03881 [Oryza sativa Indica Group]
Score 647
Evalue 3.5437e-106
Total Hit Count 25
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig70
AAGAGGATTTCTTCCTGCTGATACATCTGCCTGCAGCTTGAATGCTAAAGTTCCAGGTATCATTAGTGCTGTCCTTGTGGCTGGCGCTTACCCAATGGTA
GGAAGATTGCTCCCTCCTCGCAAAAATGCTAGAAGGGCAGTTTTGGAAACAGCAAGTGGTGCCAAAGTTCGATTACACCCGCATTCTTCCAACTTTAACT
TGTCATTTAATAAATCGTCTGGGAATCCACTAATGGTATTTGATGAAATCACTCGAGGGTGATGGCGGAATGTATGTAAAGAACTGTTCAGTTGTTGGAT
CATATCCTTTACTTCTGCTTGCTACAGAAATAGCTGTTGCTCCACCCTGATGATGTAAGTGATGAGGATGATGAAGGTTCCAGTGGGGATGAAGCGGGAA
AAAGCACTCTGGGACAACAAAAGGAAGAGATTATGTCTTCTCCCGACAACACTGTTTCAGTTGTTGTTGATCGGTGGCTCCGATTTGATGCTACTGCTCT
GGATGTTGCTCAAATATACTGCCTACGAGAACGCCTAGCATCTGCTATTCTTTTCAAAGTGAAACATCCACAGGATGTTCTCCCGCCTGCTCTTGGAGCA
ACGATGTATGCGATTGCTTGTATCCTATCGTATGATGGCTTGCCTGGTAATTTGGCAACAAGACATGGTTCAGGTCAGAGCTCAACAGATGCTAGCGGAT
CAGCTGAGGGAAGGAAAGTTGGTTTTATTCCGCCTGGCGGTTTCCTTATGTCATTGCTATCGGACGTACCGCCCAATGCACCTCATCATCAGAAGTCATC
TAATCATCCAGGGGGTGGTTCAGGGCATATTAGGTCATCAAGGGCCCCGGCTGGTAGATTTAATCAGTCGCAGCAGCATCCTGGCCGCAACAGCTCTGGA
CCAGGGAGTTCAGCATCACAATCTTTCAAAAGACAGCGGGACGCTGCACGGTGACCGTGGCTCACATGTAATTCCGTACTGGATCCCATGCTTGGGTCTC
ACAAGAAAAGTGCCATGGTTGGGAATTAACGAGGATTTTGCGGTGTTGTTGGGACGAAGGCAAAATGTGCAAGCAAGGAATATGGAAGGCAATGCCTTAA
TCTGTCAAGGAGACCATAAGA
page-top