Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig69
Contig Information
Length 579 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs13d01    rwhvs13d01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ubiquitin-like protein 5 [Hordeum vulgare]
Score 385
Evalue 1.12594e-35
Total Hit Count 162
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig69
CCAATTCTCAATCGAAAAGCACAAGGCCGCTGCAGCTCTCGCCGGGGCTAGGGTTTGGTCGATCGATCGATCAATCGACGCGAGCGGGAGCGAAGATGAT
CGAGGTGGTGCTCAACGACCGCCTGGGGAAGAAGGTGCGCGTCAAGTGCAACGAGGACGACACCATCGGCGACCTCAAGAAGCTCGTGGCGGCGCAGACC
GGGACCAGGGCCGAGAAGATCCGCATCCAGAAGTGGTACACCATCTACAAGGACCACATCACCCTCGGCGACTACGAGATCCACGACGGCATGGGCCTCG
AGCTCTACTACAACTAGCCTCCGGCCATTGCAGGTTGGTCACCTATTGTTGCCTGCGATGATAGCTTTGGTTGCATTCCAGTCCCAGTGTCTTCAGAGCT
CAATGTGTGGGCTGAACTTCAGCGAGCTACTATATAAGTAGTGCATTATTGTACCCATGATGATTATTGACAGCCTGAACATACTTTTCCTGTGATCGAC
CTGCGAATCTAATGTGCTGTTACTGTGAAGTTTATAAATAACATAAACTGTCTTACCTGGGGTTGTGATAAAAAAAAAA
page-top