Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig68
Contig Information
Length 1284 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs13d04    rwhvs13d04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Vitis vinifera]
Score 104
Evalue 0.0182913
Total Hit Count 19
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig68
CTCTCCTCTCCTCATCTCTCCTCCGCGTCTTCCTCCGGGGAGCCTTGCGGCTGCAGCAGGAGGGGAGACGAGGAGGCCGGGCCAGCCGATTTCCTCGCCG
GATCTGGAGCGCAGGGGCGACGCTGGCGAGTAACCGATCATGGAGGAGCATTGGTCGCCGGTGAAGAAAATATGGGAGGGAGACGAGAGGAGCACTGATC
AGGGGGAGTCATCAGGGATGGTCGATGCCAAGCTGATCTTATTCTGGTGAGAGTTTGATGACAGGGAGAATTATTATTATTGTTGTTGGTCAAGGAGGAG
CAATACTCAGAGTGTGAGAGTTAAGTGAGAATCTGTTGAAACTAAGGTCACAACAGATCAGGTCTGCCTATCTGTTGATGGTGATAGAAAAGGTAATGAT
GCAGCAAAAATGCATTACGATTCTAAAGCTGTCAGGGCTCAGGAGATGAGTGTCTGATGGTACTATTGATCAACATTCAGATTTGGCAGTTGGATAAAGA
AGCTTCGTTCACAATATAAAGGCTGACAAGAAAACTACAGAACGAGTAAAGATTTGCGACTTGGAAGCGATGGGATCAAATGGTTTGTCTTAAGAGAACA
ATACTATCTATTTCTTATTTATTGTACGTCAAAGACTTGCAGATGCAGAATATTAGCACAAAGAAAAATCTATATGGTTTTAAGGGTTTGGATTCATCGG
TATGTTGTGTGTTTCTTCACCTGCTCTGGATATGATTGCACAATATTTCAGAAATCGTCCATGGATATGCATTGTTAGGTGACAAGTTTTTGCGGGTGGT
ACGGTTCCCATCTGTCTCTGATGAAATATTCACTTACCATACTAGTTCGATCTCAACATTCCACCCATTTTTCACATCTCTATCATCGCTTGGATTTTGT
CTCTAACATTGTTGCTTTCCGGTGGCGAGGGAGCCCTTCACTGAGCCGGTGGAGGTGTCCTTGGCGTAGGCAGGGTAATGGATCACCGAGTGCGAGCTGC
TGTGTTGGTTCGTCAGAGAGGGTGAACAAGTGTCCAAGTAGATGAATTTTCAGCAGTTCTATGAGGTACAGACCGTACTACTGAAATAACAAGACATTTG
AAGGGAGTAGTACATCAGATTCGTTTATGGTCCTCTTGCCACCTTAATAGTGTATTTCTGACTACATTATGTTATCAATAGGTTGGTATAGCTTCCAAAT
ACCGTAGAAATCAAAGAGTTTGAACTGTTTTAACTGAGATTATGTCAATATTGTTAGTCTTTACTCCTTTGTTACTGTTTATGT
page-top