Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig67
Contig Information
Length 693 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs13d06    rwhvs13d06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein Meso_2741 [Mesorhizobium sp. BNC1] >gi|110286059|gb|ABG64118.1| protein of unknown function DUF459 [Mesorhizobium sp. BNC1]
Score 81
Evalue 3.04351
Total Hit Count 2
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig67
CCTCGTGCCGTTTTGATTTGTCGGTTCCAGCTTTTTTTTGGTTGATTGTAGCAATTTTTATCCTCCAGTAAGCAACTTCTGATTCGTCGGTTCTAACAGT
TTCTTTTGCTGGTCGTAGCTTTTCATGCCGCTAGTTTCAACTTTTTTCTTCACCGATGGCATCAATCCCCCGTTTCGAAGTAGCAACTTTTCAATTCGCA
GTTGTAACATTTTATTTCACCGGTAGTAGCTTTTTGCGGGAGGACGGAGATCGATTACGAATTTTTGCTGCAACCGTTTGTGTTTTTTGCTACTACCGGC
GATGTATTTTGCTACATCCATTCAATGTCATTTACTGGTGGTTGTTGGCTGCGCAATCCGTGCAGCGAGGGTTGACGACGAGTGGCGGCAGCAGTGCATC
ATGGGGCTACGAGCGAGCGGCCGGCAGCCGTTGCCCTCGCGGATGTGCAGACGGAGGCGGGGGCGTGTGGGGCAGAGGGGCGGGGGTGCGTGGGGTGGAG
GTTGAAGACGAGTCAAGGCGCGTGGAGATGCCAGATCGGACGACCAATCCACGCCAGATCGAAGGGTTAGGGCGCGACCGGCCCAAATTTGGGCCGGTGC
GCCGGCGCCTAGCGTCGCCCTTTTCTGAATTGTATCGGTCGTGTGCCCAACACGCAGCCCCAACTGGTCCACCATGTCTGGTTGGAGGCTCTA
page-top