Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig66
Contig Information
Length 1153 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs13o23    rwhvs13o23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit PREDICTED: similar to cadherin 11, type 2, partial [Bos taurus]
Score 82
Evalue 5.56787
Total Hit Count 2
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig66
GGTGGTTAGTTCAAACATTGGCATCATGGCTTTAGTTGTCAAATTTGTGACTTTTCCTAGAATAGATATAAATTTATTATGAATTTCATATTATAGCTGT
TACTTTCATGTTAACATGTCGTAGCATTCATAAGGTGATGTCTAAGTATTTCCCATGCAACGAGGTAATGGCTTATGACTGATGATATATGTCTTCTTTA
TATAACTTGCATATTAACTGATCCAGTGAAGCACTGGCGGAGCCTCGTGGAGGCCAAGGGGGGTCTTCCAAAACTGCATTTTCTTTCTATGTATACTAAG
CGTTTTAGTCCAGCCCTTCGGTGGATAATTGTCTCTCAATCCGATCAATTATTGCGTAGTCCATACTCCATACGTACAAAGCTAAGCTAGCTAGCATAAG
CAGTTTGATTGATTGTGCGTACAAAGCTAGCTATCTACTACAACTACAAGCAGCTTGACTGATTATTGTTAGAGCATCTTCCACATGGAATACTTGCTTG
CTTCTTCAATAGATGGATTCGTCCGCTATGTTCGATTACAATGTAATCTCATGTCATTCACATCTATTTTCATGCATCTTTTGTTGCGAGATGTGGTTAT
ACTTCCAGATAGATGTACATGTTCACAATGTTTCACCATTGTTCCACAAATTTTATTATTATGTACAAAATGGCACCATTGAGCATTCATTTCTGTTTCA
CCAGTTGAACACATAGTGCAGGAAGGAGGACATATCAGCAAGACGGGATGGGCTATTAAATATGAGATGCCAATTGTGCCAGTGCATGGAAAAATAACTA
TTTGAGAGGGAGTCAGTTCTTTTTCTAGATGCTTGCTCTGTATTTTTCAAGCCTCGGTCTTATGGCATACATATGCTTAGCAGTCGATCCTTCGTGCTGT
GAAAATGGAGCATTGGTCGCTGCTGCTCTGCACACCACCGACACCGTCCGCTCCCAACTCTCTGCTGCAGCAGCCTTGCCGCTCGCCGCCACATAAAATG
TTTGGCTTGAAGGACGGGGTTTACTGGTTAGGAACCATGTGTTTATTGTGTTCGATGTATACCTATCAATAATATAGCATCGCTTTGATGGATGTATTGA
TACTTCTGAATTATTCGGTAGCAGTGTACATGCGCTTAACTATAAGTCCACCT
page-top