Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig63
Contig Information
Length 1334 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs13e07    rwhvs13e07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0135800 [Oryza sativa (japonica cultivar-group)] >gi|46485788|gb|AAS98413.1| putative Pto kinase interactor 1 [Oryza sativa (japonica cultivar-group)] >gi|51038251|gb|AAT94054.1| unknown protein [Oryza sativa (japonica cultivar-group)] >gi|113578127|dbj|BAF16490.1| Os05g0135800 [Oryza sativa (japonica cultivar-group)] >gi|215740849|dbj|BAG97005.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218196047|gb|EEC78474.1| hypothetical protein OsI_18361 [Oryza sativa Indica Group]
Score 1706
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig63
CCTTCTTGCCTGCTTCCGCCGCTACCTGCTCCTCCTCCGCCCCTCCGCCGTCGCCGGGACACGCCCAAGCCAGGACTTGTTTTCAGAAGAATATGTCTTG
CTTTGGATGCTGTGGTGATGAAGATACTCAAAGAGCACCAGACAACAGGAATCAATACCCAGGAAGCCATCCAGCAAGGAATGATGCATACCGCACTGCC
GATCCAATTCCCAAAGGTCCTCAACCTGTGAAAGTGCAACCCATTGCAGTTCCCACCATTCCTATGGATGAAATTAGGGAGGTTACAAAGGGTTTTGGTG
ATGAGGCTTTGATTGGTGAGGGTTCCTTTGGCAGAGTATATTTTGGTACTCTAAGAAATGGTAGAGGTGCAGCAATCAAAAAGCTGGACTCCAGTAAGCA
GCCAGACCAAGAATTGCTGGCACAGGTATCTATGGTGTCAAGGCTTAAGCATGAAAATGTTGTTGAGTTGCTTGGTTACTGTCTTGATGGGAACACCCGT
GTCCTTGCTTATGAGTTTGCCACTATGGGCTCTCTTCATGATATGCTTCATGGAAGGAAAGGTGTTAAAGGGGCTCAGCCAGGTCCGGTCTTATCATGGA
TACAACGGGTGAAGATAGCTGTTGGTGCCGCGAAAGGCCTAGAGTATCTTCATGAGAAAGCACAGCCTCACGTCATACACAGGGACATCAAGTCCAGCAA
CGTTCTTCTCTTTGATGATGATGTAGCTAAAATAGCTGACTTCGATTTGTCAAACCAAGCTCCTGACATGGCAGCCCGGCTTCACTCAACTAGGGTTCTG
GGAACATTTGGATACCATGCACCTGAGTATGCGATGACTGGTCAACTTAGCTCTAAGAGCGATGTGTACAGTTTTGGAGTTGTTCTTCTGGAGCTATTGA
CTGGGAGGAAACCTGTCGACCATACATTACCGAGGGGGCAGCAGAGCCTTGTCACATGGGCCACCCCAAGACTGAGTGAAGATAAGGTTAGGCAATGTGT
TGACTCAAGACTTGGAGGGGACTATCCTCCTAAGGCTGTTGCAAAGTTTGCAGCCGTCGCGGCATTGTGCGTCCAATACGAAGCCGACTTCCGGCCAAAC
ATGAGCATCGTCGTCAAGGCGCTCCAGCCCCTGCTGAATGCGCGAGCAGCCCACCCTGGGGCTGAGCATGCCGGACGCTAAGCTCCACTCCTTGTATGAT
ATAATAGATAAGGAAAAATGAGCCATCAATTGTTGTTCTTGCGGGGCGCGTGGCAGGCGGTTTTTGTACATTTGTGATTATTCTTCCCAAGTTGTAACCC
TCGAGATTCTAGTACCAGAAATATTTGATTCTTG
page-top