Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig61
Contig Information
Length 472 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs13e09    rwhvs13e09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Histone H3.2
Score 446
Evalue 5.76415e-43
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig61
GGCCACCGGCGGCGTGAAGAAGCCCCACCGGCTTCCGCCCGGGCACCGATGGCGCTCCGGGAGATCCGCAAGGTACCAGAAGAGCACGGAGCTGCTCATC
CGCAAGCTCCCCTTCCAGCGCCTGGTGAGGGAGATAGCGCAGGACTTCAAGACCGACCTCAGGTTCCAGTCCTCCGCCGTCTCCGCCCTGCAGGAGGCCG
CCGAGGCGTATCTGGTGGGGCTCTTCGAGGACACCAACCTGTGCGCCATCCACGCCAAGCGCGTCACCATCATGCCCAAGGACATCCAGCTCGCCCGCCG
CATCCGTGGGGAGCGCGCCTAGGTTTGGCCGTAGCAGTTCGTGTCTTGCGATCTGGTTGTACTAAGGAAATGTGCTGGGTTTCTCTGTAGTGTTGATAAG
CTTTCCAGATGTTCTGACGCTGAAATGAAATGGTAATGAAAAGTTCAGTTATCTTTTGATGCAAAAAAAAAA
page-top