Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig57
Contig Information
Length 1366 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs13e18    rwhvs13e18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_023492 [Oryza sativa (japonica cultivar-group)]
Score 634
Evalue 2.75305e-66
Total Hit Count 170
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig57
TGGTTTCCGAGCCAATCCCAACTGGCATGACACAATATGGGTACTTTTCCCTCCACCGAGCTGCTGATATGTTCTCTGTTGATATGATTGAGTTGCTCTT
GCGCCATGGTGCGTCTGCCAATCTACGCACATCTGGTGATCTAGTCCCTGCTGACCTACTCCCACTCCATGTTGCGGTTGAGAACACTTCCATGCATAAG
TACCTTGAGGACAGTCTAAATCCTAGTCAACAGCGTGTGGACTGCAGCCAGGCAGACATCAACTATATCCTCAAGCTCATCCACATCCTGTGCTTACCTG
AAATGAAAATCTTCTTGGATACAACTAGGCTGCTAGCCAAACACACAGATGATCTGTTAGATGAGCTCTGCAAGTACATAGTAGATGGGAAGATCGTCCA
TACGGCTGTTTTGCTCCTAGCAGCTCAAAAGCAGATCCGCGGGCTATCTTCCTGCAATGGATGTGGGAGTAGTAAGAAAGATGGGTTTGGTACTATCACT
AACTTTGTCGTGGACAACATTACTGCTATAAAGATGCGCCAAAACAGACTGGAAATGGAGCCACTAGAGGTGAAAAAGGAGCTTCTTGATGTTACATTGA
ATCTTGTTCATGTAATTTTCAAAGCTGGTGAAGCTCTTGATGTTTACATAAGGTCTCATCCAAAGATTCCCTGTGTCATGGAAGTGGCCCATGCGGAGGT
CTTTGAACATGTTACGCTCATTCTGAAGGATCATGGATTTTTTTCTATTGGAGATGGCATAGATATTGGAAATCTCCACCCCTATCGGAATGTGCTATCC
TCTCAAGAGCTACCTCACAAATTAGCGGAGATGGCTAGGATCAAAGCAGGTCTGAAAGTGCCTTGTCTGCGAAATGGAAAGCCTAAAGTGAAGAAAGATC
CCAGGGGATGGGAGCTCAAATTTGCAAGGAGAAGTTTCTTCCAATCTCAAAGATCAGTGTTAACATCAGAGCTTAGTGTGAAGTTCTTCGCTCATAAGGA
GAAGACCTCGGATAAGTCAACCGGCAAAGCATCTATGTTCATGGGCGGAACTCTGCAGCCAAAATTTAATTATCAGCCCAGAAGGATGTTTGGTACAGTG
GCATTGACGCTGTTGAAAGCGCTAAGGAAGGCATGACGAAGGAGTTGGCAATATCTTGCAATTTACCCCCAATCATGTACCTGCATTCAAGTATTCAGTG
TGCAGGATGTGCTAAACGTGGGATGTCGTAGCAAAGTAGCAGTAACTTAAGCTCAACTTCGCAATAATTCTGAATCATGTTTTGTAAAGGAAGTTAAAAG
CCCATGCGAGTGAGACAATGGTTGCGGTGTGGCTGACAGTAGCCACAACTATTACTCTTTCAATCA
page-top