Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig56
Contig Information
Length 554 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs13g05    rwhvs13g05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ubiquitin fusion protein [Oryza sativa (indica cultivar-group)]
Score 538
Evalue 1.79106e-53
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig56
CAAGGCCAAGATCCAGGACAAGGAGGGGATCCCGCCGGACCAGCAGCGGCTGATCTTCGCGGGGAAGCAGCTGGAGGACGGGCGCACGCTGGCCGACTAC
AACATCCAGAAGGAGTCGACGCTGCACCTCGTGCTCCGCCTCCGCGGGGGCATCATCGAGCCCTCGCTCCAGGCCCTCGCCCGCAAGTACAACCAGGAGA
AGATGATCTGCCGCAAGTGCTACGCCAGGCTGCATCCAAGGGCTGTCAACTGCCGCAAGAAGAAGTGTGGCCACAGCAACCAGCTGAGGCCCAAGAAGAA
GATCAAGAACTAGAGCTCGTAAGACTGTCATCGCCGCTTTCGTTGTCTGGGTAAATCAGTAGACATAAAATGTTTTCCGGTTATCGTTTTGCTGCCCCTC
ATGTCAGGATGTTGAACCTTGGTTAACTCTAGCTGAGTACTTGCCTCGTTTTAATGTCAGAACTGAAGTGAACCTTGGCAATTAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAANANNGGGGGGNNNNAAAAAA
page-top