Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig55
Contig Information
Length 1487 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs13n15    rwhvs13n15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0200000 [Oryza sativa (japonica cultivar-group)] >gi|20804509|dbj|BAB92203.1| putative autophagocytosis protein [Oryza sativa Japonica Group] >gi|113531844|dbj|BAF04227.1| Os01g0200000 [Oryza sativa (japonica cultivar-group)]
Score 795
Evalue 1.4995e-147
Total Hit Count 172
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig55
AACTCCTCCTCCTCCTCCTGCCCCTCTCTCCCACGCTTCCCCCTTCGTCTCCGTCGACAGGAAGCAACCAGGAGAGGCGAGGCGGCGACGATGCAGATGA
AGCAGAAGGTCTACGAGCTCTACAAGGGGACGGTGGAGCGGGTCACGGGCCCGCGCACCGTCTCGGCGTTCCTCGAGAAGGGCGTCCTCTCCGTCCCCGA
GTTCATCCTCGCCGGCGACAACCTCGTATCCAAGTGCCCAACCTGGTCCTGGGAGGCGGGCGATCCGAGCAAGAGGAAGCCATACCTCCCCTCCGATAAG
CAGTTCCTCGTCACCAGGAACGTGCCCTGCCTAAGACGAGCTGTGGCGGTCGAGGAAGAGTATGATGCAGCGGGAGCTGAGGTTGTTCTCGATGATGATG
AGGATGGCGAAGGCTGGCTCGCAACACATGGGCTGCAAGCATCAGAGTCAAAAGAGGAGGAAGACATACCGTCTATGGATACATTGGACATAGGGAAAGT
CGAAGAGATCAAATCTATCCCCTCCTACTTTGGTGCTAGTGAAAAGCCAGATGAGGAGGAGGATATACCTGACATGGACACCTATGAAGACACAGGAGAT
CATTCTACAGCTACCCCTCAGCCTTCATATTTTGTCGCAGAAGAGCCTGATGATGACAACCATTCTTCTCACCAGAACATATGATGTTAGCATCACATAT
GACAAGTACTACCAAACTCCACGTGTCTGGCTTACAGGCTATGATGAGGCAAGAATGCCATTAAAGCCTGAACTTGTGTTTCAAGATATCAGTCAAGACC
ATGCACACAAAACGGTGACTATCGAAGACCATCCTCACTTGTTAGTGGGACAGCACGCTTCCGTGCATCCTTGCAAGCACGCTGCCGTGATGAAAAAAAT
CATTGATGTTATAGTGTCTCAAGGAGGTGCACCAGAAGTTGACAAGTACCTTTTCATATTTCTCAAATTCATGGCTTCTGTCATACCCACCATTGAGTAT
GATTACACTATGGATTTCGATCTGGGCAGTACAAGCACATAAGCCGCCCATTGAAGGTATGCAAAATCTCATCTTTTCACATGACACGCACACTGAAATC
ATATGGTAGAATGAAGAATCCCCCCGTGCTTGTTCAGACATCAGAACTCACTCGAGTAACCATACATTTATATCTTCAGAACTGTATAACTACATCAGGT
TGTTTTTAGACTGAGAGAGAACACATTTATCTCAAAGCTGTATAACGTATGTTGTTTCTAGATTGAGAGAGATGGTCAGATAGCTGACTGTTTGCTGGTG
TTGCAGAAAAGCTGAAACTCCCGAGAAGGTGAGCTGTTCATTGTCGCCGAATAATTGCTGCTCTTCGGAAGGATCTGTACATTGTGTCCGTGTGTGTTGG
TTCGTTTGGAAATGAACTTTCAATTGTAAACTCTGATGCTCTGCAGGAAGATTGTCCTGATTGGTCCTCTTACTGTGTGGCGCCGCA
page-top