Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig54
Contig Information
Length 1132 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs13n14    rwhvs13n14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit receptor-like kinase-like [Oryza sativa Japonica Group] >gi|50508392|dbj|BAD30392.1| receptor-like kinase-like [Oryza sativa Japonica Group]
Score 181
Evalue 2.72881e-23
Total Hit Count 63
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig54
GGGTGGAGCTGCCACCTCAACCTCAAACGCAGGAGACAATGAACAGACTTAACCATACCGCAGGCCTGGCTTTCGATCCAGCAGTCTCGTCCCATTTCCA
TGTTCTTTGTTTCGAGCGGACCTTTCCGAAAACTTTGATCACATGAGTGAACATCTACTCGTCTCGCACAGGAGCCTGGATTCATAGAGACAGCGGGATA
GTTGAGAAAGCTACCCTGTTCAGGAGTAAATGTGTCTTTGTTGGCGGTATGATGTACATCATGGGTAACCCTGGAGGACATCAACGACGAGTATGTGCTG
GTGGGGGTGGACATGGAGGGGAAAGTGTGGAAGACTATCCCGTGTGCCGTATGGTTCAAAATTTGGTACTATTGGATTGTCGCAGGGGTGCTTACACTAT
GCTATAGCTCCTCCCAATAATAGCAATGAAATCCTAGTTTCTGAGATAGCACTCTGGTGCCTCAAGGATTGTGACAGTAAACAATGGGTCCTAAAGCATA
CTGCCAGCATAGATACACTTATGAGCATGACTTGGGAGAAGTACAGGGTGGTTGAGATTCATCCAGATTGCGACACCATTTTCCTGGCTCAGTGTGGAGG
TGATACCTTGGTATCATATGACATGTCGCATCAGAAAGTGGGCTGTATCATTAATCTTGAGAAAAACAGTGTACACAAATTTCTACCCTATGTTCCTCTG
TTCTCAGAGCCATTAGCTGATGCTGAGGGGTAGTAACTTTACCTTCAAACCACCCCTATGTTTCCTCCCCAAAAACTGGCTCTTCTTTTGTCTGAACAAT
TTGTCTGTGTGCCTCTGAATCTGCTTCAATCATGCCCCCCCAATTTGCTGGCGCTTATACTCCTGCTTGCTTGATTTCCAGTTCAGACTTCAGAGTAATG
CCTGGTAAACCTACAGATTAAGCATCATTTCATTTTCAAAGAATGTTATTACCCTTGTCCGTGTTTGCCTAGCACTGGCTGTTGTTCTGGGCATGTCTTA
GTTTCATGGGGCTAAATTATACTGTGATAGGCCCTCTTATCCATAACAATCAGTTATTATTATTATCCGAAATCTTAGTGCATATTGTCAACCTACTAGT
GTACTAAAAGGTTCAGTCAGACTTGTTACTGT
page-top