Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig53
Contig Information
Length 1095 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs13f01    rwhvs13f01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_032195 [Oryza sativa (japonica cultivar-group)]
Score 640
Evalue 1.02594e-64
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig53
GGCTCTCCGCCGCCGCCGCCGCTTTCTTCTCCACGCGCCACCGCGCCATTCTACCACCCCCGCACGAACCTGCTGGACTGCTGCCCCACACCGCTTGCCC
CCACGCGCTTGAACCCTCTCCTCTGCCCCGGTGCTCTCCCCTGACCACAAGAACTCTGGCGTCGTCACCGTCATGGCGCGCGCCGGGCAGATCCAGGGGA
AGACGGGGTTCAACCTGCTGTAGAGGGACGTTGCCCTGTACTAGAAGACTGTGCCGGCCGTGGTGAAGCACTCCTCGGAGGCGCTGCTGCTCGTGGTGTC
CAACCCCGTCGATGTCTTCGCCTACCTCGCCTTGCAGCTTTCAGGGTTGGGTTCCAGGCGAGCGGCGTCATTTGCTCCTCCAAGTTCTGGTTCCTCATCA
ACGAGCCCCCCGCCATCAACACACAGGACGTGCAGGATTCCCAAACCACCACAGTGCGCCCTTCAACCGCGAACCGGTTTACTGATGCGCCTCCGCAACC
TTACAGGCCGCCGTAGTCCATGCAGCAGCTAGCAGCAAGGCCCATTGACGTCGCCGCACAGTCCAGTGCGGGCAGGAACCATTTGATGACTTCACATGGA
ATACAATTGCAACTGTGTCAAGCTTGTGCAGAAGAGACCACCAAAGTAATTATTGATGACATTGGAGATAGAAATTTTTCTTTACTTATTGATGAGTCCA
GAGATGCATCAATAAAGGAGCAAATGGCTATGGTTTTAAGGTATGTCCATAAACATGGGTATGCGATTGAGAGGTTCATTGGGATTAAGCATGTTGGTGA
CACAAGGGCAACTTCTCTAAAAGCATCTTTGGATGGTGTGTTTCTTAAACATGGCTTGTCTATGTCTAAATTGAGAGGGCAAGGGTACGATGGAGCTTCT
AACATGAGAGGACAATTTCTTGGGTTGCAAAGGTTGATACTAGATGAAAATCCTTATGCATTTTATATTCATTGCTTTGCCCATCAGTTGCAGTTAGTGG
TTGTTGATGTTGCCAAGTGTTGTTCCTCTGTATTGGATTTCTTTAACCACATAACTTTGATTGTCAACACCGTCAATGCTTCTGTAAGGGACATG
page-top