Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig52
Contig Information
Length 1037 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs13n09    rwhvs13n09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0545100 [Oryza sativa (japonica cultivar-group)] >gi|38345956|emb|CAE04350.2| OSJNBb0038F03.14 [Oryza sativa (japonica cultivar-group)] >gi|113565036|dbj|BAF15379.1| Os04g0545100 [Oryza sativa (japonica cultivar-group)] >gi|116310243|emb|CAH67251.1| OSIGBa0101C23.3 [Oryza sativa (indica cultivar-group)] >gi|215701079|dbj|BAG92503.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218195315|gb|EEC77742.1| hypothetical protein OsI_16858 [Oryza sativa Indica Group]
Score 1053
Evalue 1.20599e-112
Total Hit Count 383
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig52
CGGACGTCGTGTCGGGGTCGACGGCGTGGATCGGGAGGGGATTCTCCTGCGTCTGCGTGCAGAGGAGGGACAGCGACGCGCGCATTTCCTTCGATCTGAC
CCCCATTCAGGAAGAGTGCCTACAAAGATTACAGAACCGGATTGAGGTGCCTTATGATAGTCAAAATGGAGAGCATCAGGAAGCACTCAAAGCCCTCTGG
CATGCTTCTTTTCCTGGGACTGAACTTCTAGGACTAGTATCAGATCAATGGAAGGAGATGGGATGGCAAGGGAAAGATCCATCCACAGATTTCAGGGGTG
GTGGCTTTATCTCTTTGGAGAATTTACTTTACTTCGCTAAGAACTATCCAAAATCCTTCGAGGAGCTCCTTTGTAAGCAAAATGGTGACAGAGCATTATG
GGAATATCCATTTGCTGTAGCTGGAGTAAATATTACATTTATGCTCATTCAGATGCTTGATCTTCAAGCAGCTAAGCCAAGGTCTTTGATTGGAGCAGTG
TTCCTAAATTTACTTATAGAAAACGATCGAGCTTTTGATATTCTTTACTGCATAACCTTTAAGCTGATGGATCGGAAATGGCTTGAAATGCACGCCACAT
ATATGGATTTCAATACTGTTATTAAATCCACACGCCGCCAGCTTGAGAGAGAGCTATTACTTGAAGATATTCAGCAAATTGAGGACATGCCGTCATACAG
TTTTCTCGCCCGTTAGCAACTGAAGTCTTGCCTAACATCGCCACGTGTAGTAAAGTTCTTGACACATGCTTCTAAAGAGTGGAATGTAGGAATCAGGGAC
TCGTGCTTGTGTGGTTTTTGCTACCGTGCTTAGGTACTCTGATATCCTGAGCGCATGTTTGGGTCTTCTTGGATCTGACCTCTAGAGTAACTGGCTACCT
GAACAGCAGTTGGGCCATGCTAGTGCCGGTAGGATGTACTTTCGGAAACAATTTGTCCTGGCGCGGAGTCTTCGTGCTAGGAAATACGTAGTAAGTTCTG
AAACTCCTCAGTACTCAAGACAGCTTGAGCCAAGTCA
page-top