Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig51
Contig Information
Length 807 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs13n08    rwhvs13n08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit predicted protein [Laccaria bicolor S238N-H82] >gi|164645492|gb|EDR09740.1| predicted protein [Laccaria bicolor S238N-H82]
Score 82
Evalue 3.12488
Total Hit Count 2
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig51
ATGTCATCGTGGAGCCCTTCCACTCCGGCAACGCGCCTGCCAATGGAAGTTTTCAATCGCATTTCCTTTCGTCGTTAAGTGTCTTTTACTTTCTACCCCC
TTCTGACTTCTCGAGACCATTTAGGAGCTTGCGGGCTTCATCGCTTTCATGTTGGAGCCCCTGTTGCCGGGGTAGGCTTGGACCCGATGATGGCGAAGAT
GCTAGAGCCAGAGCCGAAGAGGGCCCCCGTAGCCCGTTGCTCGCCTACCAAGAAAAGGAAGATCGTCACACACCCAAGGAGGAAGAGGGCAATGATGACG
ATGGTGACGAGGAGGAAGGAGATGACAAGGAGGAAGACCAAAAAGGGCCCTCCACAGAGGAATGTAACTATGAGAAAGAAGTTTGGTGGCTTCACTGGCA
TGGGGTCGGAAGAGGGGCCGCAGAGAGGAAACTTTTGCAGGCCCGGCGTTGCTGGAGCGAGAGCCTCAGCTAGGTTCTTCAAGGATCCGTGATCCCATCG
AAGGGGCCAATGTGCCTCCGGTGCTAGCAGTTCTCCTCATTGTGGCGAGCCCCTGAGGAAGCACAATACTATTTGTGTCGAGCTGGCCTGCTTGCTCCAT
CAAGGAGGTCACCACGACTGGGACCTCCACCCCGCGTCCACTAGTGACGGATGCCCCCACGACCGGCTCACAAGGGCCTTGAGAGGCGATCAGGGTTCGA
CGCCTGAAGCCGTGATCTCAGAGGCATGTAAGTGTAGAGTTTGTACCTCCTTCATTAAAGTGTTGTAGCAAGTAGGCTGTGGTACTTGATATTCTTATGG
CGTCTGC
page-top