Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig50
Contig Information
Length 399 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs13f02    rwhvs13f02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_00731 [Oryza sativa Indica Group]
Score 138
Evalue 3.00866e-07
Total Hit Count 39
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig50
GCTCATCGCCTGCCCCTCCATAAGGTTCTGGAGCACCCCTGGATCGTCCAAAACGCCGACCCCTCGGGCGTGTACAGAGGGTAGAGCTTGTCTCGACTGC
TCCTGTGCCTCGATCCAGGGCTCCAGGGGTTATTTCATTGTTGTCATATCTGGCTTGCGTTAGCCGTGCCTGTACTACCTACCACCACTGTTGCTCCTGC
AGCTGCGTCGACAATGTTCATTGAAGCTTCAGCTTTACTCGATGAAGATTTGGAGCCAACATGTAGCAGCTGTCTCAAATGTGTGTTGTGAATGTTTATG
TTGTGTAGGGGGTGTGTGTGTCCTACTCTGTGTATCTCTTGTTGGACAACTATTTGGTCTATATATTGGAGGCTCCCGCAGTTCGTATCAAAAAAAAAA
page-top