Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig49
Contig Information
Length 687 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs13n05    rwhvs13n05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit amylogenin [Triticum aestivum]
Score 876
Evalue 1.94573e-92
Total Hit Count 81
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig49
GCGGAACCAACGCAACACGAACTACGTGGATGCTGTGATGACAGTTCCACTCGGTGCGATGTTCCCTGTGAGCGGTATAAATGTTGCATTCAACCGTGAG
GTTATGGGGCCCGTGATGTTCCCTGGTCTGCGGATTCGCAAGGAAGGGAAGCACAGATGGGACACCCTTGAAGACATATGGAATGGCCTGTGTGCTAAGG
TGGTCTGCGACAGCTTGGGCTATGGCGTGAAGACCGGACTGCCTTATGTGATGAGAAGTGATGCAGAGGCAGGCAAGGCCTTGGAGAGCCTCAAAGAGTG
GGAAGGGGTGAAAGTTATGGACGATGTCCTTCCCTTCTTCGAGTCGCTCAAGCTATCAAGGACCGCAGTTACTGTCGATGACTGCGTTAAGGAGCTAGCT
GGCATTGTGAGGCAGAAGCTGGCGCCAAAGAATGCAATCTTCTCCAAAGCTGCCGATGCCATGGAGGAATGGACCAAGCTCTGGAAATCTCATGGAGCTC
AGAACGCGTAATACTGGACTGCGTCCATTTTATCCATCAAGATACTTATTTTTCTTCTTCTTGGACTTTAAAATTTCCATATGCACTGTTATGATGCAGC
TGAATAAACAATGTTTCCGTGTGAGGGGAATTTGTGGTGTAGAACATGTAGTTGCCAGGTGTTCGGTTTGTGTATGCTCAAGAACCG
page-top