Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig36
Contig Information
Length 1217 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs13g18    rwhvs13g18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit elongation factor 1 alpha subunit [Malus x domestica]
Score 435
Evalue 7.05404e-41
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig36
TTAGGATGAAGTGTCGGAAATCTCGAACAGACTGCGTTTGACGGTGGTATCTGAGGTACCTGAATTGACATCAGCAGCTGGACACTTCTTCAGAGCTGGA
GCTGAAGGGAAAAGAACATGCCCTACTGTTCTACTACTGATGGCCTCGGCTATAAGAACAGACACTCTTGACTTGGTTGTTGTTTCAAGGAGCGAGCTTC
ATGCAAGACAGATGCACATTGCTCCTGCACTGTCATTGATGCTCCTGGACACCGTGATTTCATCAAGAACATGATCACTGGGACCTCCCGGGCTGATTTT
GCGGTGCTTATCATTGAATCCACCACTGGTGGTTTTGAGGCTGGTATCTCCAATGATGTCCAGACCCGTGAGCATGCTCTCCTTGCTTTCACTCTTGGCG
TCAGGCAGATGATCTGCTGCTGCAACAAGATAGATGCTACTACCCCAAAGTACTCCAGGGCTCGCTACTTTGAAATTGTCAATGAAGTTAGCTACTACTT
GAAGAAGTTTTTTGTTATTTGAAAGCAACTGACGACTCTATCAATCAGTGCACGAAGAAATCTATTTCTAAGTATCCTAAGGTGATAAGAATTGTGATTG
ACTCAGTAGGAGGAGCATGAGCAGTGGTGGAAGCAGGACCATGCGAGCTTGGACCAGGTCGCGGCACCAGATGTGGAAGATTAAGGCCTTTGCCAGGAAA
TGCAAACTGCGGCAGACGAGCACACTCCTCCAGAGAGACAGGGTATATTCTAAAATTTGTGTATGGATTTTGGGTGGTGATTACTCAAGAAGGATACCAC
ATTTATTTGTTGTCTAAACAATTTGACAGCGAACACACTAGGAGAGAATTTGCATACACTGCACCTAAAGATTTATTTGGAAACTGTCATCATGCCCAGG
CAGAAGAAAGGATACATCAGTCGACTAAATCATTTTGCAATATATCTATGTCCCACGTGTAGTAGCCATCACCAATTCTATTTCTGATCCACAACTTTCA
AATCTATAGAAGTAGGGGTCTGACTGAGTCAAAGATAATGGTACATCGAGCTGGCTATCTAAGTTACTATCTTATCTAAGATGTAATTGATGCTTTCTTT
TGCCCAATAGTATGTATTTCGATGGATTAACTTTTGTGTTAGTCATGTTTCAATGGATTAACTATTTGTGTTTGTCATGTAAAACTATGTGTCCTATGAN
CATGTGACCTTGCTATG
page-top