Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig35
Contig Information
Length 732 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs13g22    whvs20k06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_26489 [Oryza sativa Indica Group]
Score 867
Evalue 2.44711e-91
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig35
CCGCCTCCCTCTCCTCTGCACATCTCTCCTCCCTCCCCCACGACGCGGCAAAAACAGGGAGGAGAGAGAGCGAGAGAGGGAGCCCGAGCCCGAATCCCTG
CGATCCCCCCCTCCCGGTCGGAGGATCCGGCGATCAGCCATGAACGAGAAGGCCTCCGTCTCCAAGGAGCTCAACGCCAGGCACAAGAAGATATTGGAAG
GCCTTCTGCGGTTGCCGGAGAACAGAGAATGTGCAGACTGCAAGTCAAAGGGTCCTCGATGGGCAAGTGTCAATCTTGGGATCTTCGTATGCATGCAGTG
TTCTGGAATTCATAGAAGCCTTGGGGTACACATATCAAAGGTAAGGTCTGCTACTCTGGATACATGGTTGCCAGAGCAAGTTGCATTTATTCAATCAATG
GGAAATGAAAAGGCAAATGGCTATTGGGAAGCAGAGCTGCCCCCTAATTATGACAGGGTTGGGATAGAGAACTTCATCCGTGCAAAATACGAGGACAAGA
GGTGGATACCGAGGAATGGAACATCAAAACTGCCCTCTAGTGCTCGAGATGAGAAGAGCTCTGAATCTCAGGCCAGTCATGCTAACAGGGGTGGGCACGC
TCAAAAACCTTCATTTGAGCAACATCGTGTTTCACCAGCTGCTACGAAAAGAACTGTTCCAGTGGCTTCTAGGATGCACACGCAGGCATCACCTCANCCA
AAAGCAGAACTACCAGTTCCCAAGGTTGCTTC
page-top