Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig34
Contig Information
Length 1441 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs13l16    rwhvs13l16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0711600 [Oryza sativa (japonica cultivar-group)] >gi|53792638|dbj|BAD53652.1| GCIP-interacting family protein-like [Oryza sativa Japonica Group] >gi|53792876|dbj|BAD54053.1| GCIP-interacting family protein-like [Oryza sativa Japonica Group] >gi|113596591|dbj|BAF20465.1| Os06g0711600 [Oryza sativa (japonica cultivar-group)] >gi|215693889|dbj|BAG89088.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215736809|dbj|BAG95738.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1395
Evalue 4.27055e-152
Total Hit Count 482
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig34
CCGACCGTATCTCGCTTCTCCAGGCGAACCTCTAGGGTTCGTCACGATCCCCGTCGCCGCCCGCCGGATTCGACCGTCGGCAAGACCCGCCGGATTCCGG
CCCGACGCCGGTGCTGCTGCCACTACTCCTCCCTCCCTCCCTCCCGTAATCCGACTCTCCGCCTCCGCATCCACCAGGCGCAGCCCCCGTCGACCCGCAG
CAGATCCGCCGCCTCGAATCGCACCCAAGACGCGAGAGCCGAGAGCTCGATGGGGAAGTCGGAGCCGGAGTGCGTCAACTCGTCGAACCCGGCCCACGAG
TGCAATGACTACTGCCTCAACAAGATCGCCGAGGCCAAGCGCCGCCTCCTCGAAGAGCAACCCGATTCGTGGAAGGGCCCCCCGGAGGACCGCACCGTGC
ACCCTGACTGTATCAACGCCTCCAACCCCTACCATGACTGCTCCGAGTACTGCTTTAAGAAGATTGCCGACGCCAATGCAGCGGCGGAGCGCGGGGAGCT
AGAGAAGCCTGCTGGAGGTTCTGGCAAATCAGGAGTCACTCCAGAGCAGGCTGATGGTGATGATGATTCCGAGCGCCAGGAGGACGCCGCTGCAGCAGAA
GACGGTTACCCGCAGATGACCGAAAAGCAGAAGAAGCTGTTTGAGCTGCAGCTTAAGATGAACGAAGCTAGGAAGGCGAATCAGCAGGCGATGGTTGCGG
AGAAGAAGAGGATGGAGCCTCGTGGCGAGAGCAGAGGCGTATCTAAGGAGAAGTGGTTGGAAGACAGAAAAAAGAAGATTGGGAAGCTGCTTGATTCGAA
TGGCCTGGATATGTCAAAGTCTTACATGCTGGATACACAGGATATGGCAGAAGCAAAATACAAGAAGTGGGAGAAGGAACCCGCACCACATGGCTGGGAT
GTTTTCAACCAGAAAACCTTGTATGATGCATACAAGAAGAGGACAAAAAACATAGAAGTCGACATGGATGCATACAATAGAGCGAAAGAAACCGATCCTG
AATTCTACCGTGAGGCTTCAAGTCTTCAATATGGGAAGGTGTCTAGGGTGGCGGAACCCAACATCGACCGAATGGTTAATGAGCTCAAGGAGCGGGATGA
GAAGCGGAAGGCGTTCAGCAGGAGGCGCAAGTTCAACGAAGACAAGGACGTTGACTCGATCAACGACCGGAATGAGCACTTCAACAAGAAAATCGAGAGG
GCCTTTGGCAAATATACGCTTGAGATCAAGAACAACCTGGAAAGAGGGACCGCCTTGCCAGACTAACGTTCTGGCGTTTGGAGTCATCCACTCAACTGGC
AGTGCTGTTTCCCCCCTGGTTTCTTTGCTTGTAACCTGTATTCAGAATTTATTTTCTGAAGTGTTAAGAAAGTGAAACCTGGATGTAATGTAATGATGAT
GCTGTGACTGATAACATGTACAAACAGTTCTGTATCCAAAG
page-top