Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig32
Contig Information
Length 478 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs13h05    rwhvs13h05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit HvB12D [Hordeum vulgare subsp. vulgare] >gi|3445292|emb|CAA70936.1| B12Dg1 [Hordeum vulgare subsp. vulgare]
Score 453
Evalue 8.81384e-44
Total Hit Count 49
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig32
CGCCGTCGCCTCTCCACTTTCGTCTCTCTCACTCACTCTCCCCCTCCGCCGCCGGCGCAGCGTCCTCCCCGCGACTCCGATGGCCAGCAAGTGGGTCAGG
CCCGAGGTGTACCCGCTGTTCGCGGCGACGGGCGTGGCCATCGGCATCTGCGCCTTCAGCCTCCTCCGCAACATCACCGGCAACCCAGAAGTCAGGGTCA
ACAAGATGGGGAGGGCAGCAGGAGTGCTTGAGAACCATGAGGAGGGCAGGCGCTACGCCGAGCACGGTCTCAGAGCCTATGTGCAGGACAAGACCCCCGA
GATCATGCCAGGAATCAACAAGTTCTTCACCAGCCCGAAATGAAGCACTTTAGTCTCTCTGTGACTCGCTATTAGCAACTGTTGTGGTCAAGTGCAAACC
TATTTCAAGCATTCCAGTAATGTTGTCGCGTCCATAATTCAGAGGATATCATAAAGTACCTCTTATTGAAAAAAAAAA
page-top