Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig30
Contig Information
Length 729 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs13l05    rwhvs13l05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein BRAFLDRAFT_122319 [Branchiostoma floridae] >gi|210115665|gb|EEA63415.1| hypothetical protein BRAFLDRAFT_122319 [Branchiostoma floridae]
Score 93
Evalue 0.137747
Total Hit Count 21
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig30
GGAATGCACAAACAAGCTGTGGCCAGTGGGAGAGGCAAGGGGACCTGTTCACCGCTGCAAGAGGGATGTCGAAGGAACCAAAAGTGGAAGCTAGCATAGC
GACACCATGTTCATTTGTCTTCAAGAGGTGTAGTGCAAAAAAATGATACTAGTTGCCCAGGGACCAGGTGCTTTTTTCTCTTCGATGGGTGGTCACACAA
GACGATGGGGTGGAAGAAGAAAGAAGAGGGAGAGGAAGAAGGGCGTGGGGACAGCTTGGGAGAGAAGAAGAAAGGAGAGAGGGGGCAATGCTTTTGGTGA
AGCGCGTGAAGGGAGGGAGAGAAGCTGGGTGGACGGAGGGACGTGGGAGACGGTGAACCCTTTCCTTTCCAAATCTGGACTGAGGGGGGACCAAAACATA
CCTAATATGGGAGGCTGCCAGGGGGCACTAGCGGGCACACGTTTGCCAGCTAGACGCGTCCTTTGTTTGTTTGTTTGTTTCTGCGCTGATGGTGATCCGG
ACTTGTTAAACCGATTGTCACGCGCCCACGTAGTTCGTCGGTTTGACCTTCTTAGTAGCGTTTGACTTTTCTTTTACTTATCTGGCTATTAGTTTTTGTA
GCCAATTGGCTTAGAAGGTCCAACCGAGGTAGGTGTAACTGGGCCATGCTGGGTGTTGCCGTGTTAGACTTTGGGTCCAACGGCCCGGCAACCGTAATCC
CTTCGGAAAAAAGAGAGGTAATTCCATCC
page-top