Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig28
Contig Information
Length 452 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs13h16    rwhvs13h16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit retrotransposon protein, putative, Ty3-gypsy subclass [Oryza sativa (japonica cultivar-group)]
Score 102
Evalue 0.00446324
Total Hit Count 162
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig28
GTCGACGAGCTCCATCAGGTCATCCAACGGCGTGGCGAACGCCTCGGCTGTTTCGTCACTCGCTTCCAAAGCACTGCGGAGCGCGTACCAAGGCTGAGAG
ACGGCATGCTCATCACCGCCTTCGAAGCCAACGTGCGCCATCCACAACTCCGAGACTTCCTCCGATCGAGGATCGTCCACAGCATAGATGAGCTATGGAG
TATCGCCCCAGCCTACGTCGTCGACACCGACGAATCAGGGCCCCCCACCGGTGGAGGTCGCAGAAGTGTGATCTGAAGCCGAGGACGTCCCTGATAGACG
TCAGGACCGAGGAGCCAGCCTTTCCCGGCTGGCGATTGGCGACGCATCCGGCCGAAGCTGGGAGCCAGGCACTCCTGGAGCTCGTACGTGTACCGTCCAA
ATAACTGGCCCCAAGGGGGCATCGTATCTAAGTATTTTCCTCAAAAAAAAAA
page-top