Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig25
Contig Information
Length 1246 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs13k02    rwhvs13k02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0834700 [Oryza sativa (japonica cultivar-group)] >gi|113534253|dbj|BAF06636.1| Os01g0834700 [Oryza sativa (japonica cultivar-group)]
Score 1042
Evalue 2.97467e-111
Total Hit Count 271
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig25
ACGATCTGTTCAAGGTCGCCGTCAGCCAGCCCAAGGTCCCCGTTGGTGTCGACCCCAAGTCGATACTTTGCGAGTTCTTCAAGGTTGGACAATGTCAGAA
GGGTTTTAAATGCAAGTTCTCACACGACCTGAATGTCCAAAGGAAGGGTGAGAAGATTGATATTTACAGCGACAAGCGTGATGGAGAGGAAGAAGATACA
ATGGATGACTGGGATCAGGAGACCCTTGAGAAAGTTATTGCATCAAAAAACGCAGAGTACCAGCAGAACAAACCTACTGATATTGTTTGCAAGCACTTTC
TTGATGCTGTGGAGAAGAAGCAGTATGGGTGGTTTTGGGTTTGTCCAAATGGCGGCAAGGAGTGCCGCTACAGGCATGCCCTTCCGCCTGGTTATGTACT
AAAGTCTCAGATGAAAGCCTTANTAGAGGAAGAGAGTAAAAAGGTTGCAATTGAAGATGAGATTGAAGACCAGCGCAGAAAGGTTCAAACCACAACCCCT
ATGACTACAGAATTGTTCATGGAATGGAAAAGGAGGAAGGCAGAAGAAAAGGAAGCTGGTCTGGCGGCCTTGAGGGCAGATAGGGCTAAGAATGACCGTA
TGAGTGGTCGCGAGTTGTTCATGGCCGATGCAAGTGTGTTTATTGATGATGCTGAAGCATATGAAGTTTATGAAAGACGTGAAGAGCCACAAGACAACCA
GGAACAGGGCAAGAAAAGTCAGGATGAAGGTCCAAGCTCATCAACCTCTAATGGCAAGGAGGCTGATGAGGAGCCGGATGATGAAGATCTAGATGATGAC
GATGACCTAGACCTTGACGAATTAAATGAACTCGAAGCAAGCCTGTCAAGAACTTCCATTCAAATTCGGGAACCAGGTGAGGGGACATCATCTTGAACAG
GGAGGTCATTGAGAAGTCGTACTCCATTTTTGCGCTCCAAATCGGCCTACTTGCTTTATTAGACACAAAAGGGTGGAGCATAGATGCAAGTGGACATTAG
TTTCAAGTGACTATGATCATCATCTGTTTTGAGGGAGCAATGATTAACTGATGATGCCCAGTGTTAAGATCGCATGACATTTGATGTTTCCTGTGTTGCC
TTGTTGTCTTTGTGGGAGTTATTTTGCTACTTTGTGAATAACAGCACCAACGTTTTTCTAGCCTCGTGCAAAACCTATACGGAAAACCTTGGTGCGGACC
TATTTATAAGTGGTGGCCCAGGATTGTAGTCTTTTACCCCCTTGTA
page-top