Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig24
Contig Information
Length 446 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs13i18    rwhvs13i18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0967900 [Oryza sativa (japonica cultivar-group)] >gi|18844846|dbj|BAB85315.1| putative aspartyl aminopeptidase [Oryza sativa Japonica Group] >gi|113535044|dbj|BAF07427.1| Os01g0967900 [Oryza sativa (japonica cultivar-group)]
Score 581
Evalue 1.28874e-58
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig24
CCTCGTGCCGCACAGACCTGAACTACAAAACGGACTTGTTATCAAGCATAATGCTAACCAACGTTATGCCACAAGTGCTGTAACAGCTTTTCTCTTCAAA
GAAATAGCTCGAATTCATAACCTTCCCGTCCAGGAATTTGTTGTAAGGAATGATATGGGTTGTGGCTCAACTATCGGTCCCATACTTGCTTCCGGTGTTG
GCATACGGACTGTTGATTGTGGTATTCCTCAGCTTTCCATGCACAGCGTTCGGGAAATGTGTGGCAAAGAAGACATAGACACCACATACAAGCACTTCAA
AGCTTTCTTCGAGATGTTCTCGGACATTGACCAGAAACTGAATGTAGACTTTTAGCTCTTGGCATCTTAATGTGCAGTCTCTTAATAATGTATATGGATA
TTCATCTCGGCCTCTGAATAATATCTTGATCATGGTAAAAAAAAAA
page-top