Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig23
Contig Information
Length 568 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs13j09    rwhvs13j09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_26985 [Oryza sativa Indica Group] (no hit)
Score 668
Evalue 2.09869e-68
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig23
CCTCGTGCCGCTTGTGTCGATGGCCTTCATCATTCCACACCATGTGATGCTAGGAGCGCCTCCCTCTCCTCCTCATCCCCCAACTTCCAAGAAGCAATCA
TGCTGCCTGGAGCACCTTGGGCCCTTCGCCATCATCACCACCACCTCCTCCTCTTTCCTCCGGCACCTACTTCCAAGAAGGAGAGGTCGGGGGAGCTATA
GTTCATGAGGAAAGAGAGTCCGCAGGTGTAGGAGGGGGGCGGAGGAGAGAGAAGATAAAAGGGGCCAGAGGTGAGGTGTTAGCTAGCTAGAGAGATATGG
TGCATGATGATGATCTGGTTTTGGGGTTATTCTAGTGCTCATCGTGTGAGTCAAGAAACCATCATCAGATCGATGCACCCGATCTCCTTCTAGACTCCTC
CCTCCTCCTTCCTCCAGAGCTGCGCTGCCTCCTCTTCGTACGCCACGCCGCCATGGCCATGGGGAATCAAGCGACTTGGTCCGAATCGACGTCCGTGTTA
TTTTTACAGGAACTATAACTGCTTATGCAAGACAAGACGTGAGCTGCTGCTGATTGCTAAAAAAAAAA
page-top