Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig17
Contig Information
Length 681 bp
Tissue Liquid cultured tissue
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvs1g22   
Homology (BLAST) Top Hit pyruvate kinase-like [Deschampsia antarctica]
Score 175
Evalue 9.51546e-19
Total Hit Count 78
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig17
GTATATCTTTGGTACTCTAATGGAAATTCACTGCTTCCTGCCTTCTCTCTTCATATTTGGTGATATATTTTCATGAATTGTTTCACAGGCTGAGAAGGTC
TTCAACCAAGATTTGTATTTCAAGCGAACCGTGAAATATGTGGGAGAACCCATGACCCACTTGGAGTCTATTGCTTCCTCTGCAGTGCGTATTTTGTTTC
TTTTCATTTTCCAACCTTTTTTAGTGTTAGGGGAACAATTTCTGTCTTCCATTGATTTAATATCAGTCTGTGACACTTGGGTTTATAAGTCTGAAATAAT
TTGCTACGTATTTGCTAGGTGCGGGCTGCTATTAAAGTTAAGGCTTCGGTCATCATTTGCTTCACTTCATCTGGACGGGCTGCAAGGTAGAAAGATAAGA
GTATTTCTTCTTAACAGGCTTCTAGTTTAATGGCAGTTGATTCATATATTATGTCGTATCTGGTATCTGCAGGCTAATTGCCAAGTACAGGCCCACCATG
CCTGTCCTGTCCGTTGTCATTCCTCGTCTGAAAACAAATCAATTGAAGTGGAGCTTCACAGGTGCATTTGAGGNATGTTTACAGCCTTTTTCCTTGNAAC
CTTTTTGCTACCTTCTTCTGNATGNGCTATATCNANGNAANGATTCNNAACTANCATGCTGNNCTTCANCCNNANAAANAN
page-top