Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig16
Contig Information
Length 397 bp
Tissue Liquid cultured tissue
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvs7d13   
Homology (BLAST) Top Hit RecName: Full=Histone H2A.2.2
Score 262
Evalue 7.73031e-29
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig16
CATGGACGCCTCAGCCACCGGAGNCGGAGCGAANGCGAAGAAGGGCGCGGCGGGGCGCAAGGCTGGCGGNCCCAGGAAGAAGTCGGTGACGCGGTCCGTC
AAGGCCGGGCTCCAGTTCCCCGTCGGCCGCATCGGGCGCTACCTCAAGAATGGCCGGTACGCGAAGCGCGTAGGCACGGGCGCCCCCGTCTACCTCGCCG
CCGTCCTCGAGTACCTGGCCGCCNAGCTGCTGGAGCTCGCCGGGAACGCCGCCAAGGACAACAAGAAGTCNCGCATCGTGCCCAGGCACCTGCTGCTGGN
CGTGAGGAACGACCATTGAGCTCGGGAGGCTGCTGGCCGGNGTGACCATCGCGCACNGNGGCGTTCTGCCNAACATNAACNCGGTGCTGNTGCCCAA
page-top