Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig15
Contig Information
Length 922 bp
Tissue Liquid cultured tissue
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvs15c14   
Homology (BLAST) Top Hit Os02g0101700 [Oryza sativa (japonica cultivar-group)] >gi|113535122|dbj|BAF07505.1| Os02g0101700 [Oryza sativa (japonica cultivar-group)]
Score 954
Evalue 3.02401e-101
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig15
GTCTTCTTAGTCACTATAGAGATCAATTGGAGAATATATACAACGGGTGCCCAGGTAAAAAGAGAGAGAATGTTATAAGCACAGGCACCACAAGATCCGG
GCTCTAAACTTTTCACAAAAGAAACAACTTAAAGCCTATGTTATACATGGCAATGAACAAACTAACTTTGAATAAAAACTGGTGCGCATTTACATGTGCA
CCAACCATCTGTATGTTAGTTTTGAACCCACTATGAAAGATCAAACGACCCCTGGCCTTCGTTGATAGCATAAAGCAGCTTCTTGTGCATAACCTCCTTT
GTCGAGTATGGCGGAAGTTTAAGATAGTTGGCACAAGTCATGACACTAGGCAGATCATCATCTGCAGACTCTGCTGCTCCAGCTGCATTTGAAGTATTCG
CCGCAGTCGAGGAGTGCTTCCTAACGATAGTCAGCTTAGGATTTAGGGAGGCTAAGCCACCAGGTGGAAGCCGAGGAGCACCAGTCACAAACTGGCAGAA
TGCATGTTGTTGCTCCGGAGTAAATTCTGTCATGATCTCAAGTAGATTGACAATTGCTGGACTCTTCGAGGTATAACCATGATCAAACTTTATATGTTCG
ACCAGTGTCTCCGGCTCCCAAAGTTCCCGTCGACCACAAATGAGATAGTCAAGCTCTTGAGGAGAAAATATTTGGAGTGATGATATATCAAATACCTGAT
TAAATCCAGCTTTGAATGCTTCTACTTGACGCATTATTCCAGTCTTAAGTGTAGCATCCACTACCAGCGAAATGTACTCTTCTAAGTTGTAAATGCAGAC
CACTGTATTTTCTTCACCTTCCTTCAGAACAAAATCCGGATAGCCCGGAAGAGTAAAATCTAAGCATAGGTCTTCAATAGGAGCACCATGAAAGCCCCAA
TTCTTCTATTTGTTGACTATGA
page-top