Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig11
Contig Information
Length 557 bp
Tissue Liquid cultured tissue
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvs6f03   
Homology (BLAST) Top Hit unnamed protein product [Tetraodon nigroviridis]
Score 81
Evalue 1.78996
Total Hit Count 38
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig11
GCCGGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
GAGAGAGAGAGAGAGAGNNCCCCNCNCNCACCCCCCNCTCTCTCTCTCCCNNGANACNCCCCNCNCGNNNNCTCTCTCTNTNNCCNCTCNNGNGGANANA
NCNNNNGNGNGGGAGAGANCNCNANNCNCCCCCCNNNNNNAAAACNCNCNNGNNGNGANNNCNCCCCCCNNNNNNGGGGGGGGGGGNGAGANNANNGNNN
AANANNTNTCTNNNGNGCGCGNGNNCACNCNCTCTNTCTCTNTNTTTTGNGNGCNCNCGCGCGCGCNCCCCNCTCTCTCTCTCTCNNCTCTCTGTGTGTC
TCTNTNTNTCTNTNTTTTCTNNTNTCTCTTTNTCNCTCTCTCGCGCGNNNNNCNCTCTNTGTGNGNGTNNANAAACACNCNCNCTCTCTCNNCNCNANAT
ATATATNTCTCTCTCTCTCTCTCTCTCTCNCNCNCTCTCTCCNCTCTCTCTCTCTCT
page-top