Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig5
Contig Information
Length 881 bp
Tissue Liquid cultured tissue
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvs4n13   
Homology (BLAST) Top Hit Os02g0101700 [Oryza sativa (japonica cultivar-group)] >gi|113535122|dbj|BAF07505.1| Os02g0101700 [Oryza sativa (japonica cultivar-group)]
Score 964
Evalue 1.93591e-102
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig5
AGTTGGAGAATATATACAACGAGTGCCCAGGAAAATAGAGAGAGAATGTTATAAGCACAGGCACCACAAGATCCGGGCTCTAAACCTTTCACAAAAGAAA
CGACTTAAAGCCTATGTTATACATGGCAATGAACAAACTAACTTTGAATAAAAACTGGTGCATGTATGTTAGTTTTGAACCCACTATGAAAGATCAAACG
ACCCCTGGCCTTCGTTGATAGCATAAAGCAGCTTCTTGTGCATAACCTCCTTTGTCGAGTATGGCGGAAGTTTAAGATAGTTGGCACAAGTCATGACACT
AGGCAGATCATCATCTGCAGACTCTGCTGCTCCAGCTGCATTTGAAGTATTCGCCGCAGTCGAAGAGTGCTTCCTAACTATAGTCAGCTTAGGATTTAGG
GAGGCTAAGCCACCAGGTGGAAGCCGAGGAGCACCAGTCACAAACTGGCAGAATGCATGTTGTTGCTCCGGAGTAAATTCCGTCATGATCTCAAGTAGAT
TGACAATTGCTGGACTCTTCGAGGTATAACCATGATCAAACTTTATATGTTCGACCAGTGTCTCCGGCTCCCAAAGTTCCCGTCGACCACAAATGAGATA
GTCAAGCTCTTGAGGAGAAAATATTTGGAGTGATGATATATCAAATACCTGATTAAATCCAGCTTTGAATGCTTCTACTTGACGCATTATTCCAGTCTTA
AGTGTAGCATCCACTACCAGCGAAATGTACTCTTCTAAGTTGTAAATGCAGACCACTGTATTTTCTTCACCTTCCTTCAGAACAAAATCCGGATAGCCCG
GAAGAGTAAAATCTAAGCATAGGTCTTGAATAGGAGCACCACGAAAGCCCAATTCTTCTATTTGNTGACTATGNATTAGAG
page-top